<?xml version="1.0" encoding="utf-8"?>
<Party xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema">
  <partypart>
    <PartyPart>
      <character>
        <PlayerCharacter>
          <attribs>
            <item key="Level">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="74" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="74" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="2534" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="10000" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="8" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="170" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="2800" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.570188165" />
            </item>
            <item key="thirst">
              <Attribute val="10" fraction="0.7105605" />
            </item>
            <item key="AG">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="18" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="18" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="aexte">
              <WeaponSkill name="aexte" value="1" atbonus="1" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="2" atbonus="1" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="-2" atbonus="-1" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="1" atbonus="1" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="1" atbonus="1" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="11" atbonus="7" />
            </item>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="7" atbonus="4" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="11" atbonus="8" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="-2" atbonus="-1" />
            </item>
          </weaponskills>
          <skills>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="-3" />
            </item>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="12" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="-2" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="-2" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="12" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="-2" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="0" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="12" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="4" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="12" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="11" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="1" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="1" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="2" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="4" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="1" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="4" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="12" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="12" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="-4" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="0" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="-2" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="6" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="2" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="8" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="-2" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="4" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="6" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="12" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="12" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="6" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="10" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="11" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="4" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="2" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="12" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="-2" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="12" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="12" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="4" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="4" />
            </item>
            <item key="nautik">
              <StandardSkill name="nautik" value="-19" />
            </item>
            <item key="fischen">
              <StandardSkill name="fischen" value="-19" />
            </item>
          </skills>
          <magicskills>
            <item key="abvenenum">
              <MagicSkill value="-19" name="abvenenum" />
            </item>
            <item key="adleraug">
              <MagicSkill value="-19" name="adleraug" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="-19" name="adlerwolf" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="-19" name="aeolitus" />
            </item>
            <item key="analues">
              <MagicSkill value="-19" name="analues" />
            </item>
            <item key="arcano">
              <MagicSkill value="-19" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="-19" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="-19" name="axxeleratus" />
            </item>
            <item key="balsam">
              <MagicSkill value="-19" name="balsam" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="-19" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="-19" name="bannbaladin" />
            </item>
            <item key="beherrschung">
              <MagicSkill value="-19" name="beherrschung" />
            </item>
            <item key="blitz">
              <MagicSkill value="-19" name="blitz" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="-19" name="chsteigern" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="-19" name="eigenschaften" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="-19" name="eisenrost" />
            </item>
            <item key="exposami">
              <MagicSkill value="-19" name="exposami" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="flimflam">
              <MagicSkill value="-19" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="-19" name="foramen" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="-19" name="fulminictus" />
            </item>
            <item key="gardianum">
              <MagicSkill value="-19" name="gardianum" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="-19" name="geisterbannen" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="-19" name="horriphobus" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="-19" name="ignifaxius" />
            </item>
            <item key="illusionen">
              <MagicSkill value="-19" name="illusionen" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="-19" name="klarumpurum" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="motoricus">
              <MagicSkill value="-19" name="motoricus" />
            </item>
            <item key="nekropathia">
              <MagicSkill value="-19" name="nekropathia" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="-19" name="odemarcanum" />
            </item>
            <item key="paralue">
              <MagicSkill value="-19" name="paralue" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="-19" name="penetrizzel" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="-19" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="respondami">
              <MagicSkill value="-19" name="respondami" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="-19" name="ruhekoerper" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="-19" name="saftkraft" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="-19" name="sanftmut" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="-19" name="scharfesauge" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="-19" name="seeundfluss" />
            </item>
            <item key="sensibar">
              <MagicSkill value="-19" name="sensibar" />
            </item>
            <item key="silentium">
              <MagicSkill value="-19" name="silentium" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="-19" name="skelettarius" />
            </item>
            <item key="solidirid">
              <MagicSkill value="-19" name="solidirid" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="-19" name="somnigravis" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="visibili">
              <MagicSkill value="-19" name="visibili" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>847</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>2</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>859</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>255</itemid>
                <BF>-1</BF>
                <itemrep>23</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>87</itemid>
                <BF>-1</BF>
                <itemrep>895</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>88</itemid>
                <BF>-1</BF>
                <itemrep>194</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory06">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>3117</itemid>
                <BF>2</BF>
                <itemrep>259</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory07">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>35</itemid>
                <BF>-1</BF>
                <itemrep>616</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory08">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>121</itemid>
                <BF>-1</BF>
                <itemrep>987</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory09">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>24</itemid>
                <BF>-1</BF>
                <itemrep>139</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory10">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>265</itemid>
                <BF>-1</BF>
                <itemrep>347</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory11">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>218</itemid>
                <BF>4</BF>
                <itemrep>0</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory12">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>55</itemid>
                <BF>-1</BF>
                <itemrep>256</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory13">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>149</itemid>
                <BF>-1</BF>
                <itemrep>612</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory14">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>150</itemid>
                <BF>-1</BF>
                <itemrep>79</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory15">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>152</itemid>
                <BF>-1</BF>
                <itemrep>10</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory16">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>180</itemid>
                <BF>-1</BF>
                <itemrep>607</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory17">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>236</itemid>
                <BF>-1</BF>
                <itemrep>140</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory18">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>146</itemid>
                <BF>-1</BF>
                <itemrep>910</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>5</count>
              </Item>
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item xsi:nil="true" />
            </item>
            <item key="chest">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>277</itemid>
                <BF>-1</BF>
                <itemrep>942</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>76</itemid>
                <BF>-1</BF>
                <itemrep>381</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="head">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>171</itemid>
                <BF>-1</BF>
                <itemrep>566</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item xsi:nil="true" />
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>853</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>256</itemid>
                <BF>-1</BF>
                <itemrep>731</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>207</itemid>
                <BF>-1</BF>
                <itemrep>862</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="shield">
              <Item xsi:nil="true" />
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>51</itemid>
                <BF>-1</BF>
                <itemrep>16</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>84</itemid>
                <BF>-1</BF>
                <itemrep>88</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="weapon">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype>kroeten</varusestype>
                <itemid>3117</itemid>
                <BF>2</BF>
                <itemrep>675</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho05 won: 1</string>
            <string>Battle dtho14 won: 3</string>
            <string>Battle dtho20.1 won: 2</string>
            <string>Battle dtho25 won: 1</string>
            <string>[dngthorwal] Explorer: 10</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho27 won: 1</string>
            <string>Battle camp_road_3 won: 4</string>
            <string>Battle camp_road_2 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 7</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle hq13_fight1 won: 5</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_5 won: 5</string>
            <string>Found Map Piece: 30</string>
            <string>Battle f13101b won: 6</string>
            <string>Battle f13101a won: 1</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle orkueberfall2 won: 7</string>
            <string>Battle f13104 won: 6</string>
            <string>Battle f13105 won: 1</string>
            <string>Battle f13106 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle f13107 won: 1</string>
            <string>Battle f13108 won: 0</string>
            <string>Battle f13114a won: 8</string>
            <string>Battle f13116 won: 1</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle f13110 won: 5</string>
            <string>Battle f13111.1 won: 1</string>
            <string>Battle Seereise_Piratenangriff4 won: 11</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_2 won: 6</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle f0612 won: 0</string>
            <string>Battle f0613 won: 3</string>
            <string>Battle f0615 won: 7</string>
            <string>Battle f0616 won: 8</string>
            <string>Battle orkueberfall2 won: 8</string>
            <string>[map] Good guys: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle skelette won: 0</string>
            <string>Battle sordul2_barn2 won: 3</string>
            <string>[guddasun] Barn in guddasun rescued: 5</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_5 won: 2</string>
            <string>Battle ship5 won: 0</string>
            <string>Battle ship4 won: 0</string>
            <string>Battle ship3 won: 0</string>
            <string>Battle ship9 won: 0</string>
            <string>Battle ship10 won: 2</string>
            <string>Battle ship8 won: 1</string>
            <string>Battle ship6 won: 2</string>
            <string>Battle ship18 won: 1</string>
            <string>[dngship] Marbochest Riddle: 10</string>
            <string>Battle ship12 won: 1</string>
            <string>Battle ship19 won: 3</string>
            <string>Battle ship14 won: 2</string>
            <string>Battle ship17 won: 1</string>
            <string>Battle ship23b won: 4</string>
            <string>Battle ship23a won: 2</string>
            <string>Battle ship24 won: 11</string>
            <string>Battle daemon won: 10</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] Climber: 10</string>
            <string>Battle dtho50 won: 1</string>
            <string>Battle dtho48 won: 0</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Slimey: 5</string>
            <string>Battle dtho53 won: 1</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>Battle dtho55 won: 1</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho43 won: 0</string>
            <string>Battle dtho571 won: 1</string>
            <string>Battle dtho58 won: 8</string>
            <string>Battle dtho61 won: 2</string>
            <string>Battle dtho59 won: 1</string>
            <string>Battle dtho60 won: 0</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle sordul_mine1 won: 4</string>
            <string>[rovamund] Hostages of Rovamund rescued: 5</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle camp_town_2 won: 3</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle Seereise_Piratenangriff2 won: 5</string>
            <string>Battle road_random5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_town_2 won: 6</string>
            <string>Battle dobe20 won: 4</string>
            <string>Battle dobe09 won: 1</string>
            <string>Battle dobe11 won: 2</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle dobe07 won: 1</string>
            <string>Battle dobe19 won: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle robberscamp_less won: 2</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f07613 won: 0</string>
            <string>Battle f07607 won: 0</string>
            <string>Battle f07604 won: 4</string>
            <string>Battle f07611 won: 0</string>
            <string>Battle f07610 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle orkueberfall2 won: 6</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle f10001 won: 1</string>
            <string>Battle f10005 won: 2</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>Battle f10012 won: 2</string>
            <string>[dngf100] Explorer: 5</string>
            <string>[dngf100] Explorer: 5</string>
            <string>Battle f10013 won: 4</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle Seereise_Piratenangriff1 won: 1</string>
            <string>Battle Seereise_Piratenangriff3 won: 6</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_road_6 won: 5</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>[dngf129] Brave Grabber: 5</string>
            <string>Battle f12905 won: 0</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12908 won: 3</string>
            <string>[dngf129] explorer: 10</string>
            <string>[dngf129] Disarmed Trap: 10</string>
            <string>Battle fheshthot won: 8</string>
            <string>Battle f12918 won: 2</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12923 won: 0</string>
            <string>Battle f12924 won: 0</string>
            <string>Battle f12925 won: 3</string>
            <string>Battle f12927 won: 0</string>
            <string>Battle f12928 won: 0</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle fpirateband won: 11</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle f12603 won: 0</string>
            <string>Battle f12608 won: 4</string>
            <string>Battle f12607 won: 0</string>
            <string>Battle f12609 won: 2</string>
            <string>Battle f12611 won: 2</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12613 won: 1</string>
            <string>Battle f12612 won: 1</string>
            <string>Battle f12617 won: 6</string>
            <string>Battle f12618 won: 2</string>
            <string>Battle f12620 won: 2</string>
            <string>Battle f12623 won: 3</string>
            <string>[dngf126] explorer: 10</string>
            <string>[dngf126] rescuers: 25</string>
            <string>[dngf126] Crystal Crusher: 25</string>
            <string>Battle f12625 won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle f12627 won: 4</string>
            <string>[dngf126] Nameless Crushers: 50</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12628 won: 7</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Daspota_Bord_Liebesgefluester won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle Daspota_Tav_LetzteRuhe won: 5</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_Piratenkoenig won: 6</string>
            <string>Battle Daspota_Tav_ZumHolzbein won: 5</string>
            <string>Battle Daspota_Spielhaus won: 2</string>
            <string>Battle Daspota_Bord_Sonya won: 2</string>
            <string>Battle Daspota_Lagerhaus won: 1</string>
            <string>Battle Daspota_LagerhausK2 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Daspota_Tischler won: 0</string>
            <string>Battle Daspota_Segelmacher won: 1</string>
            <string>Battle Daspota_Schmied won: 0</string>
            <string>Battle Daspota_Wachhaus3 won: 0</string>
            <string>Battle betas_Vendarr won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle Daspota_Wachhaus2K2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Daspota_Wachhaus1 won: 4</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_Wachhaus2K1 won: 2</string>
            <string>Battle Daspota_Taetowierer won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle Daspota_HausKapitaeneK1 won: 3</string>
            <string>[thorwal] Imman Champ: 30</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle Seereise_Piratenangriff5 won: 2</string>
            <string>Battle camp_town_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f09402 won: 0</string>
            <string>Battle f09405 won: 0</string>
            <string>[dngf094] discovered Trapdoor: 5</string>
            <string>[dngf094] made Trapdoor operational: 10</string>
            <string>[dngf094] stupid but brave: 5</string>
            <string>Battle f09410 won: 0</string>
            <string>[dngf094] smart Move: 15</string>
            <string>Battle f09413 won: 0</string>
            <string>[dngf094] found the keys use: 10</string>
            <string>Battle f09417 won: 0</string>
            <string>[dngf094] brave Explorer: 15</string>
            <string>Battle f09422 won: 17</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f04604 won: 0</string>
            <string>Battle f04606 won: 0</string>
            <string>Battle f04607 won: 0</string>
            <string>Battle f04610 won: 0</string>
            <string>Battle f04612 won: 0</string>
            <string>Battle f04613 won: 0</string>
            <string>[dngf046] stand up and fright: 15</string>
            <string>[dngf046] smart decision: 15</string>
            <string>Battle f04615 won: 0</string>
            <string>Battle f04622 won: 0</string>
            <string>Battle f04628 won: 0</string>
            <string>Battle f04626 won: 1</string>
            <string>Battle f04625 won: 1</string>
            <string>[dngf046] found secret door: 5</string>
            <string>[dngf046] opened secret door: 10</string>
            <string>[dngf046] opened secret door: 10</string>
            <string>[dngf046] brave Explorer: 15</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f05109 won: 0</string>
            <string>Battle f05120.2 won: 0</string>
            <string>Battle f05107 won: 0</string>
            <string>Battle f05102 won: 0</string>
            <string>Battle f05103 won: 0</string>
            <string>Battle f05104 won: 0</string>
            <string>Battle f05105 won: 0</string>
            <string>Battle f05105.4 won: 0</string>
            <string>Battle f05118 won: 0</string>
            <string>Battle f05119 won: 0</string>
            <string>Battle f05118.3 won: 0</string>
            <string>Battle f05118.4 won: 0</string>
            <string>Battle f05117 won: 0</string>
            <string>Battle f05113 won: 2</string>
            <string>Battle f05115 won: 0</string>
            <string>Battle showdown won: 19</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle fight_gorah won: 9</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Fight_Whalers won: 2</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle f1081 won: 0</string>
            <string>Battle f1082 won: 0</string>
            <string>[dngf108] eatItAll: 5</string>
            <string>[dngf108] WarHelper2: 25</string>
            <string>Battle f1083a won: 0</string>
            <string>[dngf108] WarHelper1: 25</string>
            <string>Battle f1084 won: 0</string>
            <string>Battle f1086 won: 0</string>
            <string>Battle f1087 won: 0</string>
            <string>[dngf108] brave Explorer: 10</string>
            <string>Battle f1089 won: 8</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>[phexcaer] Bordell: 5</string>
            <string>Battle phex_villafight won: 1</string>
            <string>[phexcaer] Gremob: 20</string>
            <string>Battle phex_golden_temple won: 1</string>
            <string>[phexcaer] Victory over the Golden One: 20</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle dfinal_welcome won: 1</string>
            <string>Battle dfinal_toughbattle2 won: 1</string>
            <string>Battle dfinal_toughbattle1 won: 3</string>
            <string>Battle dfinal_toughbattle3 won: 1</string>
            <string>Battle dfinal_toughbattle4 won: 1</string>
            <string>Battle dfinal_toughbattle5 won: 1</string>
            <string>Battle dfinal_toughbattle6 won: 1</string>
            <string>Battle dfinal_toughbattle7 won: 6</string>
            <string>Battle dfinal_toughbattle8 won: 2</string>
            <string>Battle dfinal_toughbattle9 won: 2</string>
            <string>Battle dfinal_endbattle won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle liebespinnen_1 won: 1</string>
            <string>Battle liebeschrat_1 won: 2</string>
            <string>Battle liebewoelfe_1 won: 1</string>
            <string>Battle liebespinnen_2 won: 1</string>
            <string>Battle liebeschrat_2 won: 0</string>
            <string>Battle liebeschrat_3 won: 5</string>
            <string>Battle liebewoelfe_2 won: 1</string>
            <string>[dwoods1] Peacekeeper: 100</string>
            <string>[vidsand] THe Bards Tale: 50</string>
            <string>[liskor] Gave Items: 15</string>
            <string>[liskor] Final Love: 35</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Beilunk_Kampf1 won: 6</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Seereise_Piratenangriff3 won: 0</string>
            <string>[thorwal] Beilunk Helper: 75</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[rukian] Smelled Fishy Slaughterhouse: 10</string>
            <string>[rukian] Got the Slaughterhouse hint: 30</string>
            <string>[rukian] Rukian made peaceful: 30</string>
            <string>Battle rukcanni won: 1</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle f_dc2_skel1 won: 1</string>
            <string>Battle f_dc2_skel2 won: 5</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_ork1 won: 4</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_zom1 won: 1</string>
            <string>Battle f_dc2_zomskel won: 3</string>
            <string>Battle baernecromancer_weak won: 7</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_zom2 won: 2</string>
            <string>Battle f_dc2_ork2 won: 1</string>
            <string>[dcrypt2] Baerhag peaceful solution: 150</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>[bodon] Baerhag Axe Bringer: 50</string>
            <string>[bodon] Baerhag Finish: 100</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle tk_walk1 won: 1</string>
            <string>Battle tk_walk2 won: 4</string>
            <string>[dng_swafnir] Inquisitive: 5</string>
            <string>Battle tk_cave1 won: 1</string>
            <string>Battle tk_cave2 won: 1</string>
            <string>Battle tk_tcf1 won: 1</string>
            <string>Battle tk_tcfroom1 won: 2</string>
            <string>Battle tk_tcfroom2 won: 1</string>
            <string>Battle tk_tcf2 won: 5</string>
            <string>Battle tk_tcf3 won: 1</string>
            <string>Battle tk_tcf4 won: 1</string>
            <string>Battle tk_tcf5 won: 2</string>
            <string>[dng_swafnir] Torkils Chasm: 50</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle city_guards7 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 3</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle camp_town_2 won: 5</string>
          </xplog>
          <receivedwonders />
          <charsetup>
            <maintexid>0</maintexid>
            <weaptexid>-1</weaptexid>
            <id />
            <acc>
              <string>elf_female_01</string>
              <string>elf_hair_01</string>
              <string>elf_quiver</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>w</geschlecht>
          <klasse>
            <cclass>thief</cclass>
            <school>0</school>
          </klasse>
          <isCompanion>false</isCompanion>
          <campDuty />
          <magicUses>0</magicUses>
          <birthday>10</birthday>
          <longname>Sheela Sturmfels</longname>
          <shortname>Sheela</shortname>
          <charpic>streunerin_05.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>null</uniqueid>
          <id>2</id>
        </PlayerCharacter>
        <PlayerCharacter>
          <attribs>
            <item key="Level">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="76" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="76" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="8" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="18" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="2622" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="10000" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="1" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="190" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="3600" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.570188165" />
            </item>
            <item key="thirst">
              <Attribute val="10" fraction="0.7105605" />
            </item>
            <item key="AG">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="46" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="46" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="18" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="10" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="aexte">
              <WeaponSkill name="aexte" value="2" atbonus="1" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="11" atbonus="7" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="3" atbonus="2" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="13" atbonus="8" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="4" atbonus="2" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="2" atbonus="1" />
            </item>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="11" atbonus="7" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="3" atbonus="2" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="13" atbonus="8" />
            </item>
          </weaponskills>
          <skills>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="-2" />
            </item>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="0" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="-5" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="-1" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="6" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="0" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="12" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="0" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="-2" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="0" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="6" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="2" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="12" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="12" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="0" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="0" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="12" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="6" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="12" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="12" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="2" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="0" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="0" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="0" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="4" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="-2" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="12" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="2" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="6" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="0" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="6" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="12" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="6" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="0" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="0" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="-1" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="-2" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="2" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="6" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="6" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="4" />
            </item>
            <item key="nautik">
              <StandardSkill name="nautik" value="-19" />
            </item>
            <item key="fischen">
              <StandardSkill name="fischen" value="-19" />
            </item>
          </skills>
          <magicskills>
            <item key="abvenenum">
              <MagicSkill value="-19" name="abvenenum" />
            </item>
            <item key="adleraug">
              <MagicSkill value="-19" name="adleraug" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="-19" name="adlerwolf" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="-19" name="aeolitus" />
            </item>
            <item key="analues">
              <MagicSkill value="-19" name="analues" />
            </item>
            <item key="arcano">
              <MagicSkill value="-19" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="-19" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="-19" name="axxeleratus" />
            </item>
            <item key="balsam">
              <MagicSkill value="-19" name="balsam" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="-19" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="-19" name="bannbaladin" />
            </item>
            <item key="beherrschung">
              <MagicSkill value="-19" name="beherrschung" />
            </item>
            <item key="blitz">
              <MagicSkill value="-19" name="blitz" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="-19" name="chsteigern" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="-19" name="eigenschaften" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="-19" name="eisenrost" />
            </item>
            <item key="exposami">
              <MagicSkill value="-19" name="exposami" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="flimflam">
              <MagicSkill value="-19" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="-19" name="foramen" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="-19" name="fulminictus" />
            </item>
            <item key="gardianum">
              <MagicSkill value="-19" name="gardianum" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="-19" name="geisterbannen" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="-19" name="horriphobus" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="-19" name="ignifaxius" />
            </item>
            <item key="illusionen">
              <MagicSkill value="-19" name="illusionen" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="-19" name="klarumpurum" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="motoricus">
              <MagicSkill value="-19" name="motoricus" />
            </item>
            <item key="nekropathia">
              <MagicSkill value="-19" name="nekropathia" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="-19" name="odemarcanum" />
            </item>
            <item key="paralue">
              <MagicSkill value="-19" name="paralue" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="-19" name="penetrizzel" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="-19" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="respondami">
              <MagicSkill value="-19" name="respondami" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="-19" name="ruhekoerper" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="-19" name="saftkraft" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="-19" name="sanftmut" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="-19" name="scharfesauge" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="-19" name="seeundfluss" />
            </item>
            <item key="sensibar">
              <MagicSkill value="-19" name="sensibar" />
            </item>
            <item key="silentium">
              <MagicSkill value="-19" name="silentium" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="-19" name="skelettarius" />
            </item>
            <item key="solidirid">
              <MagicSkill value="-19" name="solidirid" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="-19" name="somnigravis" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="visibili">
              <MagicSkill value="-19" name="visibili" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>541</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>2</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>790</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>255</itemid>
                <BF>-1</BF>
                <itemrep>897</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>87</itemid>
                <BF>-1</BF>
                <itemrep>946</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>88</itemid>
                <BF>-1</BF>
                <itemrep>652</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory06">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>160</itemid>
                <BF>-1</BF>
                <itemrep>718</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory07">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>178</itemid>
                <BF>-1</BF>
                <itemrep>71</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory08">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>188</itemid>
                <BF>-1</BF>
                <itemrep>271</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory09">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>86</itemid>
                <BF>-1</BF>
                <itemrep>2</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>10</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory10">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>85</itemid>
                <BF>-1</BF>
                <itemrep>411</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory11">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>22</itemid>
                <BF>-1</BF>
                <itemrep>990</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory12">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>147</itemid>
                <BF>-1</BF>
                <itemrep>617</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory13">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>180</itemid>
                <BF>-1</BF>
                <itemrep>607</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory14">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>236</itemid>
                <BF>-1</BF>
                <itemrep>140</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory15">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>146</itemid>
                <BF>-1</BF>
                <itemrep>910</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>5</count>
              </Item>
            </item>
            <item key="inventory16">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory17">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory18">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>183</itemid>
                <BF>-1</BF>
                <itemrep>498</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="chest">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>197</itemid>
                <BF>-1</BF>
                <itemrep>913</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>76</itemid>
                <BF>-1</BF>
                <itemrep>797</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="head">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>213</itemid>
                <BF>-1</BF>
                <itemrep>830</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>165</itemid>
                <BF>-1</BF>
                <itemrep>60</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>598</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>94</itemid>
                <BF>-1</BF>
                <itemrep>502</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>220</itemid>
                <BF>-1</BF>
                <itemrep>480</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="shield">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>234</itemid>
                <BF>-1</BF>
                <itemrep>846</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>51</itemid>
                <BF>-1</BF>
                <itemrep>813</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>82</itemid>
                <BF>-1</BF>
                <itemrep>494</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="weapon">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>199</itemid>
                <BF>-1</BF>
                <itemrep>346</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho05 won: 1</string>
            <string>Battle dtho14 won: 3</string>
            <string>Battle dtho20.1 won: 2</string>
            <string>Battle dtho25 won: 4</string>
            <string>[dngthorwal] Explorer: 10</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho27 won: 1</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_2 won: 6</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>[map] HQ Elf: 5</string>
            <string>[map] HQ Elf: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle hq13_fight1 won: 5</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle f13101b won: 1</string>
            <string>Battle f13101a won: 1</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle orkueberfall2 won: 7</string>
            <string>Battle f13104 won: 1</string>
            <string>Battle f13105 won: 1</string>
            <string>Battle f13106 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_1 won: 7</string>
            <string>Battle f13107 won: 6</string>
            <string>Battle f13108 won: 0</string>
            <string>Battle f13114a won: 5</string>
            <string>Battle f13116 won: 1</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle f13110 won: 5</string>
            <string>Battle f13111.1 won: 1</string>
            <string>Battle Seereise_Piratenangriff4 won: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_2 won: 6</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_1 won: 8</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle f0612 won: 2</string>
            <string>Battle f0613 won: 0</string>
            <string>Battle f0615 won: 7</string>
            <string>Battle f0616 won: 12</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>[map] Good guys: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle skelette won: 5</string>
            <string>Battle sordul2_barn2 won: 3</string>
            <string>[guddasun] Barn in guddasun rescued: 5</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle camp_road_5 won: 2</string>
            <string>Battle ship5 won: 0</string>
            <string>Battle ship4 won: 0</string>
            <string>Battle ship3 won: 0</string>
            <string>Battle ship9 won: 0</string>
            <string>Battle ship10 won: 1</string>
            <string>Battle ship8 won: 1</string>
            <string>Battle ship6 won: 2</string>
            <string>Battle ship18 won: 3</string>
            <string>[dngship] Marbochest Riddle: 10</string>
            <string>Battle ship12 won: 1</string>
            <string>Battle ship19 won: 1</string>
            <string>Battle ship14 won: 2</string>
            <string>Battle ship17 won: 2</string>
            <string>Battle ship23b won: 1</string>
            <string>Battle ship23a won: 2</string>
            <string>Battle ship24 won: 15</string>
            <string>Battle daemon won: 10</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] Climber: 10</string>
            <string>Battle dtho50 won: 1</string>
            <string>Battle dtho48 won: 0</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Slimey: 5</string>
            <string>Battle dtho53 won: 1</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>Battle dtho55 won: 1</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho43 won: 0</string>
            <string>Battle dtho571 won: 1</string>
            <string>Battle dtho58 won: 6</string>
            <string>Battle dtho61 won: 2</string>
            <string>Battle dtho59 won: 1</string>
            <string>Battle dtho60 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle sordul_mine1 won: 4</string>
            <string>[rovamund] Hostages of Rovamund rescued: 5</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_town_2 won: 3</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle Seereise_Piratenangriff2 won: 5</string>
            <string>Battle road_random5 won: 6</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle dobe20 won: 4</string>
            <string>Battle dobe09 won: 1</string>
            <string>Battle dobe11 won: 2</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle dobe07 won: 1</string>
            <string>Battle dobe19 won: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle robberscamp_less won: 5</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle f07613 won: 0</string>
            <string>Battle f07607 won: 0</string>
            <string>Battle f07604 won: 0</string>
            <string>Battle f07611 won: 0</string>
            <string>Battle f07610 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle orkueberfall2 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>[map] 12gods Emissaries: 0</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f10001 won: 5</string>
            <string>Battle f10005 won: 2</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>Battle f10012 won: 2</string>
            <string>[dngf100] Explorer: 5</string>
            <string>[dngf100] Explorer: 5</string>
            <string>Battle f10013 won: 4</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_6 won: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Seereise_Piratenangriff1 won: 1</string>
            <string>Battle Seereise_Piratenangriff3 won: 6</string>
            <string>Battle camp_town_2 won: 6</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>[dngf129] Brave Grabber: 5</string>
            <string>Battle f12905 won: 3</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12908 won: 0</string>
            <string>[dngf129] explorer: 10</string>
            <string>[dngf129] Disarmed Trap: 10</string>
            <string>Battle fheshthot won: 8</string>
            <string>Battle f12918 won: 2</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12923 won: 4</string>
            <string>Battle f12924 won: 0</string>
            <string>Battle f12925 won: 0</string>
            <string>Battle f12927 won: 0</string>
            <string>Battle f12928 won: 0</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle fpirateband won: 7</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle f12603 won: 0</string>
            <string>Battle f12608 won: 4</string>
            <string>Battle f12607 won: 2</string>
            <string>Battle f12609 won: 2</string>
            <string>Battle f12611 won: 2</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12613 won: 6</string>
            <string>Battle f12612 won: 1</string>
            <string>Battle f12617 won: 4</string>
            <string>Battle f12618 won: 2</string>
            <string>Battle f12620 won: 2</string>
            <string>Battle f12623 won: 1</string>
            <string>[dngf126] explorer: 10</string>
            <string>[dngf126] rescuers: 25</string>
            <string>[dngf126] Crystal Crusher: 25</string>
            <string>Battle f12625 won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle f12627 won: 3</string>
            <string>[dngf126] Nameless Crushers: 50</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12628 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Daspota_Bord_Liebesgefluester won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle Daspota_Tav_LetzteRuhe won: 5</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_Piratenkoenig won: 6</string>
            <string>Battle Daspota_Tav_ZumHolzbein won: 5</string>
            <string>Battle Daspota_Spielhaus won: 2</string>
            <string>Battle Daspota_Bord_Sonya won: 2</string>
            <string>Battle Daspota_Lagerhaus won: 1</string>
            <string>Battle Daspota_LagerhausK2 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Daspota_Tischler won: 0</string>
            <string>Battle Daspota_Segelmacher won: 1</string>
            <string>Battle Daspota_Schmied won: 0</string>
            <string>Battle Daspota_Wachhaus3 won: 0</string>
            <string>Battle betas_Vendarr won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle Daspota_Wachhaus2K2 won: 1</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle Daspota_Wachhaus1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle Daspota_Wachhaus2K1 won: 0</string>
            <string>Battle Daspota_Taetowierer won: 1</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_HausKapitaeneK1 won: 3</string>
            <string>[thorwal] Imman Champ: 30</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle Seereise_Piratenangriff5 won: 2</string>
            <string>Battle camp_town_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f09402 won: 0</string>
            <string>Battle f09405 won: 0</string>
            <string>[dngf094] discovered Trapdoor: 5</string>
            <string>[dngf094] made Trapdoor operational: 10</string>
            <string>[dngf094] stupid but brave: 5</string>
            <string>Battle f09410 won: 0</string>
            <string>Battle f09413 won: 0</string>
            <string>[dngf094] found the keys use: 10</string>
            <string>Battle f09417 won: 0</string>
            <string>[dngf094] brave Explorer: 15</string>
            <string>Battle f09422 won: 17</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f04604 won: 0</string>
            <string>Battle f04606 won: 0</string>
            <string>Battle f04607 won: 0</string>
            <string>Battle f04610 won: 0</string>
            <string>Battle f04612 won: 0</string>
            <string>Battle f04613 won: 5</string>
            <string>[dngf046] stand up and fright: 15</string>
            <string>[dngf046] smart decision: 15</string>
            <string>Battle f04615 won: 0</string>
            <string>Battle f04622 won: 0</string>
            <string>Battle f04628 won: 0</string>
            <string>Battle f04626 won: 1</string>
            <string>Battle f04625 won: 1</string>
            <string>[dngf046] found secret door: 5</string>
            <string>[dngf046] opened secret door: 10</string>
            <string>[dngf046] brave Explorer: 15</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f05109 won: 0</string>
            <string>Battle f05120.2 won: 0</string>
            <string>Battle f05107 won: 0</string>
            <string>Battle f05102 won: 0</string>
            <string>Battle f05103 won: 0</string>
            <string>Battle f05104 won: 0</string>
            <string>Battle f05105 won: 0</string>
            <string>Battle f05105.4 won: 0</string>
            <string>Battle f05118 won: 0</string>
            <string>Battle f05119 won: 2</string>
            <string>Battle f05118.3 won: 0</string>
            <string>Battle f05118.4 won: 2</string>
            <string>Battle f05117 won: 0</string>
            <string>Battle f05113 won: 2</string>
            <string>Battle f05115 won: 5</string>
            <string>Battle showdown won: 19</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle fight_gorah won: 9</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Fight_Whalers won: 6</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle f1081 won: 2</string>
            <string>Battle f1082 won: 0</string>
            <string>[dngf108] eatItAll: 5</string>
            <string>[dngf108] WarHelper2: 25</string>
            <string>Battle f1083a won: 5</string>
            <string>[dngf108] WarHelper1: 25</string>
            <string>Battle f1084 won: 0</string>
            <string>Battle f1086 won: 0</string>
            <string>Battle f1087 won: 0</string>
            <string>[dngf108] brave Explorer: 10</string>
            <string>Battle f1089 won: 6</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>[phexcaer] Bordell: 5</string>
            <string>Battle phex_villafight won: 4</string>
            <string>[phexcaer] Gremob: 20</string>
            <string>Battle phex_golden_temple won: 1</string>
            <string>[phexcaer] Victory over the Golden One: 20</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle dfinal_welcome won: 1</string>
            <string>Battle dfinal_toughbattle2 won: 1</string>
            <string>Battle dfinal_toughbattle1 won: 1</string>
            <string>Battle dfinal_toughbattle3 won: 1</string>
            <string>Battle dfinal_toughbattle4 won: 1</string>
            <string>Battle dfinal_toughbattle5 won: 3</string>
            <string>Battle dfinal_toughbattle6 won: 1</string>
            <string>Battle dfinal_toughbattle7 won: 1</string>
            <string>Battle dfinal_toughbattle8 won: 2</string>
            <string>Battle dfinal_toughbattle9 won: 2</string>
            <string>Battle dfinal_endbattle won: 1</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle liebespinnen_1 won: 1</string>
            <string>Battle liebeschrat_1 won: 0</string>
            <string>Battle liebewoelfe_1 won: 1</string>
            <string>Battle liebespinnen_2 won: 1</string>
            <string>Battle liebeschrat_2 won: 3</string>
            <string>Battle liebeschrat_3 won: 0</string>
            <string>Battle liebewoelfe_2 won: 1</string>
            <string>[dwoods1] Peacekeeper: 100</string>
            <string>[vidsand] THe Bards Tale: 50</string>
            <string>[liskor] Gave Items: 15</string>
            <string>[liskor] Final Love: 35</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Beilunk_Kampf1 won: 6</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle Seereise_Piratenangriff3 won: 0</string>
            <string>[thorwal] Beilunk Helper: 75</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[rukian] Smelled Fishy Slaughterhouse: 10</string>
            <string>[rukian] Got the Slaughterhouse hint: 30</string>
            <string>[rukian] Rukian made peaceful: 30</string>
            <string>Battle rukcanni won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_skel1 won: 6</string>
            <string>Battle f_dc2_skel2 won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_ork1 won: 1</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle f_dc2_zom1 won: 1</string>
            <string>Battle f_dc2_zomskel won: 3</string>
            <string>Battle baernecromancer_weak won: 2</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle f_dc2_zom2 won: 2</string>
            <string>Battle f_dc2_ork2 won: 6</string>
            <string>[dcrypt2] Baerhag peaceful solution: 150</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>[bodon] Baerhag Axe Bringer: 50</string>
            <string>[bodon] Baerhag Finish: 100</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle tk_walk1 won: 4</string>
            <string>Battle tk_walk2 won: 1</string>
            <string>[dng_swafnir] Inquisitive: 5</string>
            <string>Battle tk_cave1 won: 1</string>
            <string>Battle tk_cave2 won: 1</string>
            <string>Battle tk_tcf1 won: 1</string>
            <string>Battle tk_tcfroom1 won: 2</string>
            <string>Battle tk_tcfroom2 won: 5</string>
            <string>Battle tk_tcf2 won: 1</string>
            <string>Battle tk_tcf3 won: 1</string>
            <string>Battle tk_tcf4 won: 1</string>
            <string>Battle tk_tcf5 won: 6</string>
            <string>[dng_swafnir] Torkils Chasm: 50</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle orkueberfall won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall2 won: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle finalfight won: 96</string>
            <string>Battle city_guards7 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle camp_town_2 won: 0</string>
          </xplog>
          <receivedwonders />
          <charsetup>
            <maintexid>1</maintexid>
            <weaptexid>-1</weaptexid>
            <id />
            <acc>
              <string>barbarian_hair_01</string>
              <string>barbarian_arm plate_01_L</string>
              <string>barbarian_arm plate_01_R</string>
              <string>barbarian_leg plate_R</string>
              <string>barbarian_leg plate_R</string>
              <string>barbarian_boot_02</string>
              <string>elf_quiver</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>m</geschlecht>
          <klasse>
            <cclass>warrior</cclass>
            <school>0</school>
          </klasse>
          <isCompanion>false</isCompanion>
          <campDuty />
          <magicUses>0</magicUses>
          <birthday>14</birthday>
          <longname>Lares Farino</longname>
          <shortname>Lares</shortname>
          <charpic>krieger_07.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>null</uniqueid>
          <id>1</id>
        </PlayerCharacter>
        <PlayerCharacter>
          <attribs>
            <item key="Level">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="84" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="84" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="10" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="2533" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="10000" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="10" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="150" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="3000" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.570188165" />
            </item>
            <item key="thirst">
              <Attribute val="10" fraction="0.7105605" />
            </item>
            <item key="AG">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="20" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="10" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="aexte">
              <WeaponSkill name="aexte" value="11" atbonus="7" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="10" atbonus="6" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="9" atbonus="8" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="2" atbonus="1" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="3" atbonus="2" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="0" atbonus="0" />
            </item>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="10" atbonus="6" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="2" atbonus="1" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="1" atbonus="1" />
            </item>
          </weaponskills>
          <skills>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="-3" />
            </item>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="-2" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="2" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="2" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="-2" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="0" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="2" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="0" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="2" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="-4" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="9" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="-2" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="12" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="0" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="12" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="12" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="12" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="6" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="6" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="1" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="1" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="0" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="-3" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="-1" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="8" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="0" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="-4" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="12" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="6" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="6" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="-4" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="10" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="11" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="-2" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="-4" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="0" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="-3" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="12" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="6" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="6" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="12" />
            </item>
            <item key="nautik">
              <StandardSkill name="nautik" value="-19" />
            </item>
            <item key="fischen">
              <StandardSkill name="fischen" value="-19" />
            </item>
          </skills>
          <magicskills>
            <item key="abvenenum">
              <MagicSkill value="-19" name="abvenenum" />
            </item>
            <item key="adleraug">
              <MagicSkill value="-19" name="adleraug" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="-19" name="adlerwolf" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="-19" name="aeolitus" />
            </item>
            <item key="analues">
              <MagicSkill value="-19" name="analues" />
            </item>
            <item key="arcano">
              <MagicSkill value="-19" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="-19" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="-19" name="axxeleratus" />
            </item>
            <item key="balsam">
              <MagicSkill value="-19" name="balsam" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="-19" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="-19" name="bannbaladin" />
            </item>
            <item key="beherrschung">
              <MagicSkill value="-19" name="beherrschung" />
            </item>
            <item key="blitz">
              <MagicSkill value="-19" name="blitz" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="-19" name="chsteigern" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="-19" name="eigenschaften" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="-19" name="eisenrost" />
            </item>
            <item key="exposami">
              <MagicSkill value="-19" name="exposami" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="flimflam">
              <MagicSkill value="-19" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="-19" name="foramen" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="-19" name="fulminictus" />
            </item>
            <item key="gardianum">
              <MagicSkill value="-19" name="gardianum" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="-19" name="geisterbannen" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="-19" name="horriphobus" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="-19" name="ignifaxius" />
            </item>
            <item key="illusionen">
              <MagicSkill value="-19" name="illusionen" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="-19" name="klarumpurum" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="motoricus">
              <MagicSkill value="-19" name="motoricus" />
            </item>
            <item key="nekropathia">
              <MagicSkill value="-19" name="nekropathia" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="-19" name="odemarcanum" />
            </item>
            <item key="paralue">
              <MagicSkill value="-19" name="paralue" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="-19" name="penetrizzel" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="-19" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="respondami">
              <MagicSkill value="-19" name="respondami" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="-19" name="ruhekoerper" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="-19" name="saftkraft" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="-19" name="sanftmut" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="-19" name="scharfesauge" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="-19" name="seeundfluss" />
            </item>
            <item key="sensibar">
              <MagicSkill value="-19" name="sensibar" />
            </item>
            <item key="silentium">
              <MagicSkill value="-19" name="silentium" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="-19" name="skelettarius" />
            </item>
            <item key="solidirid">
              <MagicSkill value="-19" name="solidirid" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="-19" name="somnigravis" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="visibili">
              <MagicSkill value="-19" name="visibili" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>668</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>2</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>762</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>255</itemid>
                <BF>-1</BF>
                <itemrep>870</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>87</itemid>
                <BF>-1</BF>
                <itemrep>8</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>88</itemid>
                <BF>-1</BF>
                <itemrep>29</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory06">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>214</itemid>
                <BF>-1</BF>
                <itemrep>881</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory07">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>26</itemid>
                <BF>-1</BF>
                <itemrep>56</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory08">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>27</itemid>
                <BF>-1</BF>
                <itemrep>924</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory09">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>73</itemid>
                <BF>-1</BF>
                <itemrep>380</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory10">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>276</itemid>
                <BF>0</BF>
                <itemrep>0</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory11">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>13</itemid>
                <BF>-1</BF>
                <itemrep>738</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>20</count>
              </Item>
            </item>
            <item key="inventory12">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>151</itemid>
                <BF>-1</BF>
                <itemrep>856</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory13">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>180</itemid>
                <BF>-1</BF>
                <itemrep>607</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory14">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>236</itemid>
                <BF>-1</BF>
                <itemrep>140</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory15">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>146</itemid>
                <BF>-1</BF>
                <itemrep>910</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>5</count>
              </Item>
            </item>
            <item key="inventory16">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory17">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory18">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>182</itemid>
                <BF>-1</BF>
                <itemrep>285</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="chest">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>54</itemid>
                <BF>-1</BF>
                <itemrep>37</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>76</itemid>
                <BF>-1</BF>
                <itemrep>49</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="head">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>213</itemid>
                <BF>-1</BF>
                <itemrep>668</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>165</itemid>
                <BF>-1</BF>
                <itemrep>344</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>999</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>177</itemid>
                <BF>-1</BF>
                <itemrep>385</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>220</itemid>
                <BF>-1</BF>
                <itemrep>218</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="shield">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>7</itemid>
                <BF>-1</BF>
                <itemrep>429</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>51</itemid>
                <BF>-1</BF>
                <itemrep>217</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>82</itemid>
                <BF>-1</BF>
                <itemrep>794</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="weapon">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>159</itemid>
                <BF>-1</BF>
                <itemrep>981</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho05 won: 1</string>
            <string>Battle dtho14 won: 3</string>
            <string>Battle dtho20.1 won: 3</string>
            <string>Battle dtho25 won: 1</string>
            <string>[dngthorwal] Explorer: 10</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho27 won: 1</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_2 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle hq13_fight1 won: 8</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle f13101b won: 1</string>
            <string>Battle f13101a won: 1</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Doctor: 5</string>
            <string>Battle orkueberfall2 won: 7</string>
            <string>Battle f13104 won: 1</string>
            <string>Battle f13105 won: 1</string>
            <string>Battle f13106 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle f13107 won: 1</string>
            <string>Battle f13108 won: 2</string>
            <string>Battle f13114a won: 5</string>
            <string>Battle f13116 won: 1</string>
            <string>[dngf131] 20: 0</string>
            <string>Doctor: 5</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle f13110 won: 5</string>
            <string>Battle f13111.1 won: 1</string>
            <string>Battle Seereise_Piratenangriff4 won: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle f0612 won: 0</string>
            <string>Battle f0613 won: 0</string>
            <string>Battle f0615 won: 7</string>
            <string>Battle f0616 won: 8</string>
            <string>[dngf061] RiskHole Survivor: 50</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>[map] Good guys: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle skelette won: 0</string>
            <string>Battle sordul2_barn2 won: 3</string>
            <string>[guddasun] Barn in guddasun rescued: 5</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle camp_road_5 won: 2</string>
            <string>Battle ship5 won: 0</string>
            <string>Battle ship4 won: 0</string>
            <string>Battle ship3 won: 0</string>
            <string>Battle ship9 won: 0</string>
            <string>Battle ship10 won: 1</string>
            <string>Battle ship8 won: 1</string>
            <string>Battle ship6 won: 2</string>
            <string>Battle ship18 won: 1</string>
            <string>[dngship] Marbochest Riddle: 10</string>
            <string>Battle ship12 won: 1</string>
            <string>Battle ship19 won: 1</string>
            <string>Battle ship14 won: 2</string>
            <string>Battle ship17 won: 1</string>
            <string>Battle ship23b won: 1</string>
            <string>Battle ship23a won: 2</string>
            <string>Battle ship24 won: 11</string>
            <string>Battle daemon won: 10</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] Climber: 10</string>
            <string>Battle dtho50 won: 1</string>
            <string>Battle dtho48 won: 0</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Slimey: 5</string>
            <string>Battle dtho53 won: 1</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>Battle dtho55 won: 1</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho43 won: 0</string>
            <string>Battle dtho571 won: 1</string>
            <string>Battle dtho58 won: 6</string>
            <string>Battle dtho61 won: 2</string>
            <string>Battle dtho59 won: 1</string>
            <string>Battle dtho60 won: 0</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle sordul_mine1 won: 4</string>
            <string>[rovamund] Hostages of Rovamund rescued: 5</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_town_2 won: 3</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle Seereise_Piratenangriff2 won: 5</string>
            <string>Battle road_random5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle dobe20 won: 4</string>
            <string>Battle dobe09 won: 1</string>
            <string>Battle dobe11 won: 2</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle dobe07 won: 1</string>
            <string>Battle dobe19 won: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Brave Holegrabber: 5</string>
            <string>[dngober] great Spotter: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle robberscamp_less won: 2</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f07613 won: 0</string>
            <string>Battle f07607 won: 0</string>
            <string>Battle f07604 won: 0</string>
            <string>Battle f07611 won: 0</string>
            <string>Battle f07610 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle orkueberfall2 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f10001 won: 1</string>
            <string>Battle f10005 won: 2</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>Battle f10012 won: 2</string>
            <string>[dngf100] Explorer: 5</string>
            <string>[dngf100] Explorer: 5</string>
            <string>Battle f10013 won: 4</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Seereise_Piratenangriff1 won: 1</string>
            <string>Battle Seereise_Piratenangriff3 won: 6</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>[dngf129] Brave Grabber: 5</string>
            <string>Battle f12905 won: 0</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12908 won: 0</string>
            <string>[dngf129] explorer: 10</string>
            <string>[dngf129] Disarmed Trap: 10</string>
            <string>Battle fheshthot won: 8</string>
            <string>Battle f12918 won: 2</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12923 won: 0</string>
            <string>Battle f12924 won: 0</string>
            <string>Battle f12925 won: 0</string>
            <string>Battle f12927 won: 0</string>
            <string>Battle f12928 won: 0</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle fpirateband won: 7</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle f12603 won: 0</string>
            <string>Battle f12608 won: 4</string>
            <string>Battle f12607 won: 0</string>
            <string>Battle f12609 won: 2</string>
            <string>Battle f12611 won: 2</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12613 won: 1</string>
            <string>Battle f12612 won: 1</string>
            <string>Battle f12617 won: 4</string>
            <string>Battle f12618 won: 2</string>
            <string>Battle f12620 won: 2</string>
            <string>Battle f12623 won: 1</string>
            <string>[dngf126] explorer: 10</string>
            <string>[dngf126] rescuers: 25</string>
            <string>[dngf126] Crystal Crusher: 25</string>
            <string>Battle f12625 won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle f12627 won: 3</string>
            <string>[dngf126] Nameless Crushers: 50</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12628 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Daspota_Bord_Liebesgefluester won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle Daspota_Tav_LetzteRuhe won: 5</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_Piratenkoenig won: 6</string>
            <string>Battle Daspota_Tav_ZumHolzbein won: 5</string>
            <string>Battle Daspota_Spielhaus won: 2</string>
            <string>Doctor: 5</string>
            <string>Battle Daspota_Bord_Sonya won: 2</string>
            <string>Battle Daspota_Lagerhaus won: 1</string>
            <string>Battle Daspota_LagerhausK2 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Daspota_Tischler won: 0</string>
            <string>Battle Daspota_Segelmacher won: 1</string>
            <string>Battle Daspota_Schmied won: 0</string>
            <string>Battle Daspota_Wachhaus3 won: 0</string>
            <string>Battle betas_Vendarr won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle Daspota_Wachhaus2K2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Daspota_Wachhaus1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_Wachhaus2K1 won: 0</string>
            <string>Battle Daspota_Taetowierer won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_HausKapitaeneK1 won: 3</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle Seereise_Piratenangriff5 won: 2</string>
            <string>Battle camp_town_2 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f09402 won: 0</string>
            <string>Battle f09405 won: 2</string>
            <string>[dngf094] discovered Trapdoor: 5</string>
            <string>[dngf094] made Trapdoor operational: 10</string>
            <string>[dngf094] stupid but brave: 5</string>
            <string>Battle f09410 won: 2</string>
            <string>Battle f09413 won: 0</string>
            <string>[dngf094] found the keys use: 10</string>
            <string>Battle f09417 won: 2</string>
            <string>[dngf094] brave Explorer: 15</string>
            <string>Battle f09422 won: 17</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle orkueberfall won: 2</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle f04604 won: 0</string>
            <string>[dngf046] found secret door: 5</string>
            <string>[dngf046] opened secret door: 10</string>
            <string>Battle f04606 won: 0</string>
            <string>Battle f04607 won: 0</string>
            <string>Battle f04610 won: 0</string>
            <string>Battle f04612 won: 0</string>
            <string>Battle f04613 won: 0</string>
            <string>[dngf046] stand up and fright: 15</string>
            <string>[dngf046] smart decision: 15</string>
            <string>Battle f04615 won: 0</string>
            <string>Battle f04622 won: 0</string>
            <string>Battle f04628 won: 0</string>
            <string>[dngf046] opened secret door: 10</string>
            <string>Battle f04626 won: 1</string>
            <string>[dngf046] found secret door: 5</string>
            <string>[dngf046] opened secret door: 10</string>
            <string>Battle f04625 won: 1</string>
            <string>[dngf046] found secret door: 5</string>
            <string>[dngf046] brave Explorer: 15</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f05109 won: 0</string>
            <string>Battle f05120.2 won: 0</string>
            <string>Battle f05107 won: 0</string>
            <string>Battle f05102 won: 0</string>
            <string>Battle f05103 won: 0</string>
            <string>Battle f05104 won: 0</string>
            <string>Battle f05105 won: 0</string>
            <string>Battle f05105.4 won: 0</string>
            <string>Battle f05118 won: 0</string>
            <string>Battle f05119 won: 0</string>
            <string>Battle f05118.3 won: 0</string>
            <string>Battle f05118.4 won: 0</string>
            <string>Battle f05117 won: 0</string>
            <string>Battle f05113 won: 2</string>
            <string>Battle f05115 won: 0</string>
            <string>Battle showdown won: 19</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle fight_gorah won: 9</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Fight_Whalers won: 2</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle f1081 won: 0</string>
            <string>Battle f1082 won: 0</string>
            <string>[dngf108] eatItAll: 5</string>
            <string>[dngf108] WarHelper2: 25</string>
            <string>Battle f1083a won: 0</string>
            <string>[dngf108] WarHelper1: 25</string>
            <string>Battle f1084 won: 4</string>
            <string>Battle f1086 won: 0</string>
            <string>Battle f1087 won: 0</string>
            <string>[dngf108] brave Explorer: 10</string>
            <string>Battle f1089 won: 6</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>[phexcaer] Bordell: 5</string>
            <string>Battle phex_villafight won: 1</string>
            <string>[phexcaer] Gremob: 20</string>
            <string>Battle phex_golden_temple won: 1</string>
            <string>[phexcaer] Victory over the Golden One: 20</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle dfinal_welcome won: 2</string>
            <string>Battle dfinal_toughbattle2 won: 1</string>
            <string>Battle dfinal_toughbattle1 won: 1</string>
            <string>Battle dfinal_toughbattle3 won: 1</string>
            <string>Battle dfinal_toughbattle4 won: 4</string>
            <string>Battle dfinal_toughbattle5 won: 1</string>
            <string>Battle dfinal_toughbattle6 won: 1</string>
            <string>Battle dfinal_toughbattle7 won: 1</string>
            <string>Battle dfinal_toughbattle8 won: 2</string>
            <string>Battle dfinal_toughbattle9 won: 2</string>
            <string>Battle dfinal_endbattle won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle liebespinnen_1 won: 1</string>
            <string>Battle liebeschrat_1 won: 0</string>
            <string>Battle liebewoelfe_1 won: 1</string>
            <string>Battle liebespinnen_2 won: 1</string>
            <string>Battle liebeschrat_2 won: 0</string>
            <string>Battle liebeschrat_3 won: 0</string>
            <string>Battle liebewoelfe_2 won: 1</string>
            <string>[dwoods1] Peacekeeper: 100</string>
            <string>[vidsand] THe Bards Tale: 50</string>
            <string>[liskor] Gave Items: 15</string>
            <string>[liskor] Final Love: 35</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Beilunk_Kampf1 won: 6</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Seereise_Piratenangriff3 won: 0</string>
            <string>[thorwal] Beilunk Helper: 75</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[rukian] Smelled Fishy Slaughterhouse: 10</string>
            <string>[rukian] Got the Slaughterhouse hint: 30</string>
            <string>[rukian] Rukian made peaceful: 30</string>
            <string>Battle rukcanni won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_skel1 won: 1</string>
            <string>Battle f_dc2_skel2 won: 2</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Doctor: 5</string>
            <string>Doctor: 5</string>
            <string>Battle f_dc2_ork1 won: 1</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_zom1 won: 1</string>
            <string>Battle f_dc2_zomskel won: 3</string>
            <string>Battle baernecromancer_weak won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_zom2 won: 2</string>
            <string>Battle f_dc2_ork2 won: 1</string>
            <string>[dcrypt2] Baerhag peaceful solution: 150</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Doctor: 5</string>
            <string>[bodon] Baerhag Axe Bringer: 50</string>
            <string>[bodon] Baerhag Finish: 100</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle tk_walk1 won: 1</string>
            <string>Battle tk_walk2 won: 1</string>
            <string>[dng_swafnir] Inquisitive: 5</string>
            <string>Battle tk_cave1 won: 1</string>
            <string>Battle tk_cave2 won: 3</string>
            <string>Battle tk_tcf1 won: 1</string>
            <string>Battle tk_tcfroom1 won: 2</string>
            <string>Battle tk_tcfroom2 won: 1</string>
            <string>Battle tk_tcf2 won: 1</string>
            <string>Battle tk_tcf3 won: 5</string>
            <string>Battle tk_tcf4 won: 1</string>
            <string>Battle tk_tcf5 won: 2</string>
            <string>[dng_swafnir] Torkils Chasm: 50</string>
            <string>Doctor: 5</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Doctor: 5</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle city_guards7 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle camp_town_2 won: 0</string>
          </xplog>
          <receivedwonders />
          <charsetup>
            <maintexid>8</maintexid>
            <weaptexid>-1</weaptexid>
            <id />
            <acc>
              <string>dwarf_rgl_body</string>
              <string>dwarf_head_beard_02</string>
              <string>dwarf_helmet_02</string>
              <string>dwarf_shoulder pad_01</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>m</geschlecht>
          <klasse>
            <cclass>dwarf</cclass>
            <school>0</school>
          </klasse>
          <isCompanion>false</isCompanion>
          <campDuty />
          <magicUses>0</magicUses>
          <birthday>12</birthday>
          <longname>Geron, Sohn des Ugosch</longname>
          <shortname>Geron</shortname>
          <charpic>zwerg_03.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>null</uniqueid>
          <id>5</id>
        </PlayerCharacter>
        <PlayerCharacter>
          <attribs>
            <item key="Level">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="78" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="78" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="1" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="2529" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="10000" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="200" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="4200" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.570188165" />
            </item>
            <item key="thirst">
              <Attribute val="10" fraction="0.7105605" />
            </item>
            <item key="AG">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="19" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="6" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="aexte">
              <WeaponSkill name="aexte" value="11" atbonus="7" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="10" atbonus="6" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="-3" atbonus="-2" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="1" atbonus="1" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="2" atbonus="1" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="0" atbonus="0" />
            </item>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="11" atbonus="7" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="9" atbonus="8" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="9" atbonus="6" />
            </item>
          </weaponskills>
          <skills>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="-4" />
            </item>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="-1" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="-4" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="-1" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="0" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="-5" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="12" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="0" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="12" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="-2" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="3" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="12" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="0" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="2" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="-1" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="2" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="4" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="6" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="6" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="1" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="1" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="-3" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="1" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="2" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="8" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="-4" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="2" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="1" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="6" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="0" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="12" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="10" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="9" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="1" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="2" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="-2" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="-2" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="2" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="6" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="6" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="12" />
            </item>
            <item key="nautik">
              <StandardSkill name="nautik" value="-19" />
            </item>
            <item key="fischen">
              <StandardSkill name="fischen" value="-19" />
            </item>
          </skills>
          <magicskills>
            <item key="abvenenum">
              <MagicSkill value="-19" name="abvenenum" />
            </item>
            <item key="adleraug">
              <MagicSkill value="-19" name="adleraug" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="-19" name="adlerwolf" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="-19" name="aeolitus" />
            </item>
            <item key="analues">
              <MagicSkill value="-19" name="analues" />
            </item>
            <item key="arcano">
              <MagicSkill value="-19" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="-19" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="-19" name="axxeleratus" />
            </item>
            <item key="balsam">
              <MagicSkill value="-19" name="balsam" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="-19" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="-19" name="bannbaladin" />
            </item>
            <item key="beherrschung">
              <MagicSkill value="-19" name="beherrschung" />
            </item>
            <item key="blitz">
              <MagicSkill value="-19" name="blitz" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="-19" name="chsteigern" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="-19" name="eigenschaften" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="-19" name="eisenrost" />
            </item>
            <item key="exposami">
              <MagicSkill value="-19" name="exposami" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="flimflam">
              <MagicSkill value="-19" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="-19" name="foramen" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="-19" name="fulminictus" />
            </item>
            <item key="gardianum">
              <MagicSkill value="-19" name="gardianum" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="-19" name="geisterbannen" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="-19" name="horriphobus" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="-19" name="ignifaxius" />
            </item>
            <item key="illusionen">
              <MagicSkill value="-19" name="illusionen" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="-19" name="klarumpurum" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="motoricus">
              <MagicSkill value="-19" name="motoricus" />
            </item>
            <item key="nekropathia">
              <MagicSkill value="-19" name="nekropathia" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="-19" name="odemarcanum" />
            </item>
            <item key="paralue">
              <MagicSkill value="-19" name="paralue" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="-19" name="penetrizzel" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="-19" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="respondami">
              <MagicSkill value="-19" name="respondami" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="-19" name="ruhekoerper" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="-19" name="saftkraft" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="-19" name="sanftmut" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="-19" name="scharfesauge" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="-19" name="seeundfluss" />
            </item>
            <item key="sensibar">
              <MagicSkill value="-19" name="sensibar" />
            </item>
            <item key="silentium">
              <MagicSkill value="-19" name="silentium" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="-19" name="skelettarius" />
            </item>
            <item key="solidirid">
              <MagicSkill value="-19" name="solidirid" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="-19" name="somnigravis" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="visibili">
              <MagicSkill value="-19" name="visibili" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>541</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>2</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>465</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>255</itemid>
                <BF>-1</BF>
                <itemrep>199</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>87</itemid>
                <BF>-1</BF>
                <itemrep>326</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>88</itemid>
                <BF>-1</BF>
                <itemrep>283</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory06">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>158</itemid>
                <BF>1</BF>
                <itemrep>443</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory07">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>92</itemid>
                <BF>-1</BF>
                <itemrep>276</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory08">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>91</itemid>
                <BF>-1</BF>
                <itemrep>573</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory09">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>89</itemid>
                <BF>-1</BF>
                <itemrep>213</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory10">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>34</itemid>
                <BF>-1</BF>
                <itemrep>156</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory11">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>97</itemid>
                <BF>-1</BF>
                <itemrep>7</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory12">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>153</itemid>
                <BF>-1</BF>
                <itemrep>518</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory13">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>180</itemid>
                <BF>-1</BF>
                <itemrep>607</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory14">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>236</itemid>
                <BF>-1</BF>
                <itemrep>140</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory15">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>146</itemid>
                <BF>-1</BF>
                <itemrep>910</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>5</count>
              </Item>
            </item>
            <item key="inventory16">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory17">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory18">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>182</itemid>
                <BF>-1</BF>
                <itemrep>183</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="chest">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>54</itemid>
                <BF>-1</BF>
                <itemrep>898</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>76</itemid>
                <BF>-1</BF>
                <itemrep>677</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="head">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>77</itemid>
                <BF>-1</BF>
                <itemrep>643</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>207</itemid>
                <BF>-1</BF>
                <itemrep>996</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>812</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>173</itemid>
                <BF>-1</BF>
                <itemrep>36</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>165</itemid>
                <BF>-1</BF>
                <itemrep>831</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="shield">
              <Item xsi:nil="true" />
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>51</itemid>
                <BF>-1</BF>
                <itemrep>223</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>82</itemid>
                <BF>-1</BF>
                <itemrep>414</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="weapon">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>158</itemid>
                <BF>1</BF>
                <itemrep>443</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho05 won: 1</string>
            <string>Battle dtho14 won: 3</string>
            <string>Battle dtho20.1 won: 2</string>
            <string>Battle dtho25 won: 1</string>
            <string>[dngthorwal] Explorer: 10</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho27 won: 4</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_2 won: 3</string>
            <string>Battle camp_road_3 won: 4</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle hq13_fight1 won: 5</string>
            <string>Battle camp_road_1 won: 10</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle f13101b won: 1</string>
            <string>Battle f13101a won: 1</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle orkueberfall2 won: 11</string>
            <string>Battle f13104 won: 1</string>
            <string>Battle f13105 won: 6</string>
            <string>Battle f13106 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle f13107 won: 1</string>
            <string>Battle f13108 won: 0</string>
            <string>Battle f13114a won: 5</string>
            <string>Battle f13116 won: 1</string>
            <string>Battle road_random5 won: 7</string>
            <string>Battle f13110 won: 8</string>
            <string>Battle f13111.1 won: 1</string>
            <string>Battle Seereise_Piratenangriff4 won: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 5</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle f0612 won: 0</string>
            <string>Battle f0613 won: 0</string>
            <string>Battle f0615 won: 11</string>
            <string>Battle f0616 won: 8</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>[map] Good guys: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle skelette won: 0</string>
            <string>Battle sordul2_barn2 won: 3</string>
            <string>[guddasun] Barn in guddasun rescued: 5</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle camp_road_5 won: 2</string>
            <string>Battle ship5 won: 1</string>
            <string>Battle ship4 won: 1</string>
            <string>Battle ship3 won: 0</string>
            <string>Battle ship9 won: 4</string>
            <string>Battle ship10 won: 1</string>
            <string>Battle ship8 won: 1</string>
            <string>Battle ship6 won: 2</string>
            <string>Battle ship18 won: 1</string>
            <string>[dngship] Marbochest Riddle: 10</string>
            <string>Battle ship12 won: 1</string>
            <string>Battle ship19 won: 1</string>
            <string>Battle ship14 won: 2</string>
            <string>Battle ship17 won: 1</string>
            <string>Battle ship23b won: 1</string>
            <string>Battle ship23a won: 2</string>
            <string>Battle ship24 won: 11</string>
            <string>Battle daemon won: 12</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle dtho50 won: 3</string>
            <string>Battle dtho48 won: 3</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Slimey: 5</string>
            <string>Battle dtho53 won: 2</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>Battle dtho55 won: 4</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho43 won: 3</string>
            <string>Battle dtho571 won: 1</string>
            <string>Battle dtho58 won: 6</string>
            <string>Battle dtho61 won: 2</string>
            <string>Battle dtho59 won: 1</string>
            <string>Battle dtho60 won: 0</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle orkueberfall2 won: 8</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle sordul_mine1 won: 4</string>
            <string>[rovamund] Hostages of Rovamund rescued: 5</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_town_2 won: 3</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle Seereise_Piratenangriff2 won: 5</string>
            <string>Battle road_random5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_town_2 won: 6</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle dobe20 won: 4</string>
            <string>Battle dobe09 won: 1</string>
            <string>Battle dobe11 won: 2</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle dobe07 won: 1</string>
            <string>Battle dobe19 won: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle robberscamp_less won: 2</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f07613 won: 3</string>
            <string>Battle f07607 won: 0</string>
            <string>Battle f07604 won: 0</string>
            <string>Battle f07611 won: 4</string>
            <string>Battle f07610 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle orkueberfall2 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f10001 won: 1</string>
            <string>Battle f10005 won: 2</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>Battle f10012 won: 2</string>
            <string>[dngf100] Explorer: 5</string>
            <string>[dngf100] Explorer: 5</string>
            <string>Battle f10013 won: 9</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Seereise_Piratenangriff1 won: 6</string>
            <string>Battle Seereise_Piratenangriff3 won: 6</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_town_2 won: 6</string>
            <string>[dngf129] Brave Grabber: 5</string>
            <string>Battle f12905 won: 0</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12908 won: 0</string>
            <string>[dngf129] explorer: 10</string>
            <string>[dngf129] Disarmed Trap: 10</string>
            <string>Battle fheshthot won: 8</string>
            <string>Battle f12918 won: 2</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12923 won: 0</string>
            <string>Battle f12924 won: 3</string>
            <string>Battle f12925 won: 0</string>
            <string>Battle f12927 won: 0</string>
            <string>Battle f12928 won: 3</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle fpirateband won: 7</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle f12603 won: 0</string>
            <string>Battle f12608 won: 4</string>
            <string>Battle f12607 won: 0</string>
            <string>Battle f12609 won: 2</string>
            <string>Battle f12611 won: 2</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12613 won: 1</string>
            <string>Battle f12612 won: 6</string>
            <string>Battle f12617 won: 4</string>
            <string>Battle f12618 won: 2</string>
            <string>Battle f12620 won: 2</string>
            <string>Battle f12623 won: 1</string>
            <string>[dngf126] explorer: 10</string>
            <string>[dngf126] rescuers: 25</string>
            <string>[dngf126] Crystal Crusher: 25</string>
            <string>Battle f12625 won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Daspota_Bord_Liebesgefluester won: 6</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle Daspota_Tav_LetzteRuhe won: 7</string>
            <string>Battle Daspota_Tav_HakenHugo won: 5</string>
            <string>Battle Daspota_Tav_HakenHugo won: 5</string>
            <string>Battle Daspota_Tav_Piratenkoenig won: 8</string>
            <string>Battle Daspota_Tav_ZumHolzbein won: 9</string>
            <string>Battle Daspota_Spielhaus won: 2</string>
            <string>Battle Daspota_Bord_Sonya won: 3</string>
            <string>Battle Daspota_Lagerhaus won: 6</string>
            <string>Battle Daspota_LagerhausK2 won: 5</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle Daspota_Tischler won: 4</string>
            <string>Battle Daspota_Segelmacher won: 1</string>
            <string>Battle Daspota_Schmied won: 1</string>
            <string>Battle Daspota_Wachhaus3 won: 4</string>
            <string>Battle betas_Vendarr won: 1</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle Daspota_Wachhaus2K2 won: 6</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Daspota_Wachhaus1 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_Wachhaus2K1 won: 0</string>
            <string>Battle Daspota_Taetowierer won: 4</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_HausKapitaeneK1 won: 7</string>
            <string>[thorwal] Imman Champ: 30</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle Seereise_Piratenangriff5 won: 2</string>
            <string>Battle camp_town_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f09402 won: 0</string>
            <string>Battle f09405 won: 0</string>
            <string>[dngf094] discovered Trapdoor: 5</string>
            <string>[dngf094] made Trapdoor operational: 10</string>
            <string>[dngf094] stupid but brave: 5</string>
            <string>Battle f09410 won: 0</string>
            <string>Battle f09413 won: 0</string>
            <string>[dngf094] found the keys use: 10</string>
            <string>Battle f09417 won: 0</string>
            <string>[dngf094] brave Explorer: 15</string>
            <string>Battle f09422 won: 17</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f04604 won: 0</string>
            <string>Battle f04606 won: 0</string>
            <string>Battle f04607 won: 0</string>
            <string>Battle f04610 won: 0</string>
            <string>Battle f04612 won: 0</string>
            <string>Battle f04613 won: 0</string>
            <string>[dngf046] stand up and fright: 15</string>
            <string>[dngf046] smart decision: 15</string>
            <string>Battle f04615 won: 4</string>
            <string>Battle f04622 won: 0</string>
            <string>Battle f04628 won: 0</string>
            <string>Battle f04626 won: 1</string>
            <string>Battle f04625 won: 1</string>
            <string>[dngf046] brave Explorer: 15</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle f05109 won: 0</string>
            <string>[dngf051] Riddle 1 solved: -1</string>
            <string>Battle f05120.2 won: 1</string>
            <string>Battle f05107 won: 5</string>
            <string>Battle f05102 won: 0</string>
            <string>Battle f05103 won: 0</string>
            <string>Battle f05104 won: 1</string>
            <string>Battle f05105 won: 3</string>
            <string>Battle f05105.4 won: 0</string>
            <string>Battle f05118 won: 0</string>
            <string>Battle f05119 won: 0</string>
            <string>Battle f05118.3 won: 3</string>
            <string>Battle f05118.4 won: 0</string>
            <string>Battle f05117 won: 0</string>
            <string>Battle f05113 won: 2</string>
            <string>Battle f05115 won: 0</string>
            <string>Battle showdown won: 22</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle fight_gorah won: 9</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>[map] Shipwreck Rescue: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Fight_Whalers won: 2</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle f1081 won: 0</string>
            <string>Battle f1082 won: 0</string>
            <string>[dngf108] eatItAll: 5</string>
            <string>[dngf108] WarHelper2: 25</string>
            <string>Battle f1083a won: 0</string>
            <string>[dngf108] WarHelper1: 25</string>
            <string>Battle f1084 won: 0</string>
            <string>Battle f1086 won: 1</string>
            <string>Battle f1087 won: 2</string>
            <string>[dngf108] brave Explorer: 10</string>
            <string>Battle f1089 won: 6</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 2</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>[phexcaer] Bordell: 5</string>
            <string>Battle phex_villafight won: 1</string>
            <string>[phexcaer] Gremob: 20</string>
            <string>Battle phex_golden_temple won: 3</string>
            <string>[phexcaer] Victory over the Golden One: 20</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle dfinal_welcome won: 1</string>
            <string>Battle dfinal_toughbattle2 won: 3</string>
            <string>Battle dfinal_toughbattle1 won: 1</string>
            <string>Battle dfinal_toughbattle3 won: 1</string>
            <string>Battle dfinal_toughbattle4 won: 1</string>
            <string>Battle dfinal_toughbattle5 won: 1</string>
            <string>Battle dfinal_toughbattle6 won: 6</string>
            <string>Battle dfinal_toughbattle7 won: 1</string>
            <string>Battle dfinal_toughbattle8 won: 2</string>
            <string>Battle dfinal_toughbattle9 won: 2</string>
            <string>Battle dfinal_endbattle won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle liebespinnen_1 won: 1</string>
            <string>Battle liebeschrat_1 won: 0</string>
            <string>Battle liebewoelfe_1 won: 1</string>
            <string>Battle liebespinnen_2 won: 1</string>
            <string>Battle liebeschrat_2 won: 0</string>
            <string>Battle liebeschrat_3 won: 0</string>
            <string>Battle liebewoelfe_2 won: 1</string>
            <string>[dwoods1] Peacekeeper: 100</string>
            <string>[vidsand] THe Bards Tale: 50</string>
            <string>[liskor] Gave Items: 15</string>
            <string>[liskor] Final Love: 35</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Beilunk_Kampf1 won: 11</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Seereise_Piratenangriff3 won: 0</string>
            <string>[map] Shipwreck Rescue: 10</string>
            <string>[thorwal] Beilunk Helper: 75</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[rukian] Smelled Fishy Slaughterhouse: 10</string>
            <string>[rukian] Got the Slaughterhouse hint: 30</string>
            <string>[rukian] Rukian made peaceful: 30</string>
            <string>Battle rukcanni won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_skel1 won: 1</string>
            <string>Battle f_dc2_skel2 won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_ork1 won: 1</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_zom1 won: 6</string>
            <string>Battle f_dc2_zomskel won: 3</string>
            <string>Battle baernecromancer_weak won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_zom2 won: 6</string>
            <string>Battle f_dc2_ork2 won: 1</string>
            <string>[dcrypt2] Baerhag peaceful solution: 150</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>[bodon] Baerhag Axe Bringer: 50</string>
            <string>[bodon] Baerhag Finish: 100</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle tk_walk1 won: 1</string>
            <string>Battle tk_walk2 won: 1</string>
            <string>[dng_swafnir] Inquisitive: 5</string>
            <string>Battle tk_cave1 won: 6</string>
            <string>Battle tk_cave2 won: 1</string>
            <string>Battle tk_tcf1 won: 1</string>
            <string>Battle tk_tcfroom1 won: 2</string>
            <string>Battle tk_tcfroom2 won: 1</string>
            <string>Battle tk_tcf2 won: 1</string>
            <string>Battle tk_tcf3 won: 1</string>
            <string>Battle tk_tcf4 won: 5</string>
            <string>Battle tk_tcf5 won: 2</string>
            <string>[dng_swafnir] Torkils Chasm: 50</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall2 won: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle city_guards7 won: 2</string>
            <string>Battle city_guards6 won: 3</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 3</string>
            <string>Battle camp_town_2 won: 0</string>
          </xplog>
          <receivedwonders />
          <charsetup>
            <maintexid>0</maintexid>
            <weaptexid>2</weaptexid>
            <id />
            <acc>
              <string>villager_female_A_body</string>
              <string>barbarian_helmet_04</string>
              <string>barbarian_arm plate_01_L001</string>
              <string>barbarian_arm plate_01_L</string>
              <string>barbarian_knee_pad_L</string>
              <string>barbarian_knee_pad_L001</string>
              <string>elf_quiver</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>w</geschlecht>
          <klasse>
            <cclass>viking</cclass>
            <school>0</school>
          </klasse>
          <isCompanion>false</isCompanion>
          <campDuty />
          <magicUses>0</magicUses>
          <birthday>28</birthday>
          <longname>Frenja Tulasdotter</longname>
          <shortname>Frenja</shortname>
          <charpic>thorwalerin_01.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>null</uniqueid>
          <id>6</id>
        </PlayerCharacter>
        <PlayerCharacter>
          <attribs>
            <item key="Level">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="50" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="50" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="56" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="56" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="10" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="9" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="2572" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="10000" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="9" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="195" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="3000" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.570188165" />
            </item>
            <item key="thirst">
              <Attribute val="10" fraction="0.7105605" />
            </item>
            <item key="AG">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="19" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="aexte">
              <WeaponSkill name="aexte" value="-1" atbonus="-1" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="3" atbonus="2" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="11" atbonus="7" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="3" atbonus="2" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="10" atbonus="6" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="3" atbonus="2" />
            </item>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="2" atbonus="1" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="2" atbonus="1" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="-3" atbonus="-2" />
            </item>
          </weaponskills>
          <skills>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="12" />
            </item>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="2" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="-6" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="2" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="2" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="12" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="-2" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="0" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="2" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="-6" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="9" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="-2" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="-1" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="-1" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="3" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="4" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="5" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="8" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="6" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="-5" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="0" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="2" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="-1" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="3" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="12" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="12" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="2" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="-2" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="8" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="-3" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="2" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="8" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="12" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="1" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="4" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="-3" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="12" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="1" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="8" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="12" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="-2" />
            </item>
            <item key="nautik">
              <StandardSkill name="nautik" value="-19" />
            </item>
            <item key="fischen">
              <StandardSkill name="fischen" value="-19" />
            </item>
          </skills>
          <magicskills>
            <item key="abvenenum">
              <MagicSkill value="4" name="abvenenum" />
            </item>
            <item key="adleraug">
              <MagicSkill value="4" name="adleraug" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="4" name="adlerwolf" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="1" name="aeolitus" />
            </item>
            <item key="analues">
              <MagicSkill value="-19" name="analues" />
            </item>
            <item key="arcano">
              <MagicSkill value="-19" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="6" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="8" name="axxeleratus" />
            </item>
            <item key="balsam">
              <MagicSkill value="12" name="balsam" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="2" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="12" name="bannbaladin" />
            </item>
            <item key="beherrschung">
              <MagicSkill value="-1" name="beherrschung" />
            </item>
            <item key="blitz">
              <MagicSkill value="10" name="blitz" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="-1" name="chsteigern" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="0" name="eigenschaften" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="-19" name="eisenrost" />
            </item>
            <item key="exposami">
              <MagicSkill value="4" name="exposami" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="flimflam">
              <MagicSkill value="6" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="-19" name="foramen" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="12" name="fulminictus" />
            </item>
            <item key="gardianum">
              <MagicSkill value="-19" name="gardianum" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="-19" name="geisterbannen" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="-19" name="horriphobus" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="-19" name="ignifaxius" />
            </item>
            <item key="illusionen">
              <MagicSkill value="-19" name="illusionen" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="-19" name="klarumpurum" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="motoricus">
              <MagicSkill value="-5" name="motoricus" />
            </item>
            <item key="nekropathia">
              <MagicSkill value="-9" name="nekropathia" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="1" name="odemarcanum" />
            </item>
            <item key="paralue">
              <MagicSkill value="-19" name="paralue" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="-4" name="penetrizzel" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="-7" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="respondami">
              <MagicSkill value="-6" name="respondami" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="6" name="ruhekoerper" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="-19" name="saftkraft" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="12" name="sanftmut" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="10" name="scharfesauge" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="4" name="seeundfluss" />
            </item>
            <item key="sensibar">
              <MagicSkill value="6" name="sensibar" />
            </item>
            <item key="silentium">
              <MagicSkill value="8" name="silentium" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="-19" name="skelettarius" />
            </item>
            <item key="solidirid">
              <MagicSkill value="4" name="solidirid" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="6" name="somnigravis" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="visibili">
              <MagicSkill value="8" name="visibili" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
            <item key="destructibo">
              <MagicSkill value="-19" name="destructibo" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>850</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>2</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>106</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>255</itemid>
                <BF>-1</BF>
                <itemrep>826</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>87</itemid>
                <BF>-1</BF>
                <itemrep>756</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>88</itemid>
                <BF>-1</BF>
                <itemrep>729</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory06">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>216</itemid>
                <BF>4</BF>
                <itemrep>0</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory07">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>95</itemid>
                <BF>-1</BF>
                <itemrep>875</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory08">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>28</itemid>
                <BF>-1</BF>
                <itemrep>806</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory09">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>161</itemid>
                <BF>5</BF>
                <itemrep>947</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory10">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>777</itemid>
                <BF>-1</BF>
                <itemrep>67</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory11">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>146</itemid>
                <BF>-1</BF>
                <itemrep>910</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory12">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>155</itemid>
                <BF>-1</BF>
                <itemrep>891</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>5</count>
              </Item>
            </item>
            <item key="inventory13">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory14">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory15">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory16">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory17">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory18">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item xsi:nil="true" />
            </item>
            <item key="chest">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>81</itemid>
                <BF>-1</BF>
                <itemrep>446</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>76</itemid>
                <BF>-1</BF>
                <itemrep>941</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="head">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>171</itemid>
                <BF>-1</BF>
                <itemrep>626</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item xsi:nil="true" />
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>395</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>215</itemid>
                <BF>-1</BF>
                <itemrep>785</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item xsi:nil="true" />
            </item>
            <item key="shield">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>10</itemid>
                <BF>-1</BF>
                <itemrep>173</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>50</count>
              </Item>
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>51</itemid>
                <BF>-1</BF>
                <itemrep>723</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>84</itemid>
                <BF>-1</BF>
                <itemrep>103</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="weapon">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>274</itemid>
                <BF>0</BF>
                <itemrep>0</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho05 won: 1</string>
            <string>Battle dtho14 won: 3</string>
            <string>Battle dtho20.1 won: 2</string>
            <string>Battle dtho25 won: 1</string>
            <string>[dngthorwal] Explorer: 10</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho27 won: 1</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>[map] good Hunter: 10</string>
            <string>Battle camp_road_2 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle hq13_fight1 won: 5</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle f13101b won: 1</string>
            <string>Battle f13101a won: 1</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle orkueberfall2 won: 7</string>
            <string>Battle f13104 won: 1</string>
            <string>Battle f13105 won: 1</string>
            <string>Battle f13106 won: 7</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle f13107 won: 1</string>
            <string>Battle f13108 won: 0</string>
            <string>Battle f13114a won: 5</string>
            <string>Battle f13116 won: 6</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle f13110 won: 5</string>
            <string>Battle f13111.1 won: 1</string>
            <string>Battle Seereise_Piratenangriff4 won: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle camp_road_1 won: 7</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle f0612 won: 0</string>
            <string>Battle f0613 won: 0</string>
            <string>Battle f0615 won: 7</string>
            <string>Battle f0616 won: 8</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>[map] great Hunter: 20</string>
            <string>[map] Good guys: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle skelette won: 0</string>
            <string>Battle sordul2_barn2 won: 3</string>
            <string>[guddasun] Barn in guddasun rescued: 5</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle camp_road_5 won: 2</string>
            <string>Battle ship5 won: 0</string>
            <string>Battle ship4 won: 0</string>
            <string>Battle ship3 won: 0</string>
            <string>Battle ship9 won: 0</string>
            <string>Battle ship10 won: 1</string>
            <string>Battle ship8 won: 1</string>
            <string>Battle ship6 won: 2</string>
            <string>Battle ship18 won: 1</string>
            <string>[dngship] Marbochest Riddle: 10</string>
            <string>Battle ship12 won: 1</string>
            <string>Battle ship19 won: 1</string>
            <string>Battle ship14 won: 2</string>
            <string>Battle ship17 won: 1</string>
            <string>Battle ship23b won: 1</string>
            <string>Battle ship23a won: 2</string>
            <string>Battle ship24 won: 11</string>
            <string>Battle daemon won: 10</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] Climber: 10</string>
            <string>Battle dtho50 won: 1</string>
            <string>Battle dtho48 won: 0</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Slimey: 5</string>
            <string>Battle dtho53 won: 1</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>Battle dtho55 won: 1</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho43 won: 0</string>
            <string>Battle dtho571 won: 1</string>
            <string>Battle dtho58 won: 6</string>
            <string>Battle dtho61 won: 2</string>
            <string>Battle dtho59 won: 1</string>
            <string>Battle dtho60 won: 0</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle sordul_mine1 won: 4</string>
            <string>[rovamund] Hostages of Rovamund rescued: 5</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_town_2 won: 3</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle Seereise_Piratenangriff2 won: 5</string>
            <string>Battle road_random5 won: 3</string>
            <string>[map] great Hunter: 20</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle dobe20 won: 4</string>
            <string>Battle dobe09 won: 1</string>
            <string>Battle dobe11 won: 2</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle dobe07 won: 1</string>
            <string>Battle dobe19 won: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle robberscamp_less won: 2</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f07613 won: 0</string>
            <string>Battle f07607 won: 0</string>
            <string>Battle f07604 won: 0</string>
            <string>Battle f07611 won: 0</string>
            <string>Battle f07610 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle orkueberfall2 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f10001 won: 1</string>
            <string>Battle f10005 won: 2</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>Battle f10012 won: 2</string>
            <string>[dngf100] Explorer: 5</string>
            <string>[dngf100] Explorer: 5</string>
            <string>Battle f10013 won: 4</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Seereise_Piratenangriff1 won: 1</string>
            <string>Battle Seereise_Piratenangriff3 won: 6</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>[dngf129] Brave Grabber: 5</string>
            <string>Battle f12905 won: 0</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12908 won: 0</string>
            <string>[dngf129] explorer: 10</string>
            <string>[dngf129] Disarmed Trap: 10</string>
            <string>Battle fheshthot won: 8</string>
            <string>Battle f12918 won: 2</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12923 won: 0</string>
            <string>Battle f12924 won: 0</string>
            <string>Battle f12925 won: 0</string>
            <string>Battle f12927 won: 0</string>
            <string>Battle f12928 won: 0</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle fpirateband won: 7</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle camp_town_2 won: 6</string>
            <string>Battle f12603 won: 0</string>
            <string>Battle f12608 won: 4</string>
            <string>Battle f12607 won: 0</string>
            <string>Battle f12609 won: 2</string>
            <string>Battle f12611 won: 2</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12613 won: 1</string>
            <string>Battle f12612 won: 1</string>
            <string>Battle f12617 won: 4</string>
            <string>Battle f12618 won: 6</string>
            <string>Battle f12620 won: 2</string>
            <string>Battle f12623 won: 1</string>
            <string>[dngf126] explorer: 10</string>
            <string>[dngf126] rescuers: 25</string>
            <string>[dngf126] Crystal Crusher: 25</string>
            <string>Battle f12625 won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle f12627 won: 3</string>
            <string>[dngf126] Nameless Crushers: 50</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12628 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Daspota_Bord_Liebesgefluester won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle Daspota_Tav_LetzteRuhe won: 5</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_Piratenkoenig won: 6</string>
            <string>Battle Daspota_Tav_ZumHolzbein won: 5</string>
            <string>Battle Daspota_Spielhaus won: 2</string>
            <string>Battle Daspota_Bord_Sonya won: 2</string>
            <string>Battle Daspota_Lagerhaus won: 1</string>
            <string>Battle Daspota_LagerhausK2 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Daspota_Tischler won: 0</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle Daspota_Segelmacher won: 1</string>
            <string>Battle Daspota_Schmied won: 0</string>
            <string>Battle Daspota_Wachhaus3 won: 0</string>
            <string>Battle betas_Vendarr won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle Daspota_Wachhaus2K2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Daspota_Wachhaus1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_Wachhaus2K1 won: 0</string>
            <string>Battle Daspota_Taetowierer won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_HausKapitaeneK1 won: 3</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle Seereise_Piratenangriff5 won: 2</string>
            <string>Battle camp_town_2 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f09402 won: 5</string>
            <string>Battle f09405 won: 0</string>
            <string>[dngf094] discovered Trapdoor: 5</string>
            <string>[dngf094] made Trapdoor operational: 10</string>
            <string>[dngf094] stupid but brave: 5</string>
            <string>Battle f09410 won: 0</string>
            <string>Battle f09413 won: 0</string>
            <string>[dngf094] found the keys use: 10</string>
            <string>Battle f09417 won: 0</string>
            <string>[dngf094] brave Explorer: 15</string>
            <string>Battle f09422 won: 22</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f04604 won: 0</string>
            <string>Battle f04606 won: 3</string>
            <string>Battle f04607 won: 0</string>
            <string>Battle f04610 won: 3</string>
            <string>Battle f04612 won: 0</string>
            <string>Battle f04613 won: 0</string>
            <string>[dngf046] stand up and fright: 15</string>
            <string>[dngf046] smart decision: 15</string>
            <string>Battle f04615 won: 0</string>
            <string>Battle f04622 won: 3</string>
            <string>Battle f04628 won: 0</string>
            <string>Battle f04626 won: 1</string>
            <string>Battle f04625 won: 1</string>
            <string>[dngf046] brave Explorer: 15</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f05109 won: 0</string>
            <string>Battle f05120.2 won: 0</string>
            <string>Battle f05107 won: 0</string>
            <string>Battle f05102 won: 0</string>
            <string>Battle f05103 won: 0</string>
            <string>Battle f05104 won: 0</string>
            <string>Battle f05105 won: 0</string>
            <string>Battle f05105.4 won: 0</string>
            <string>[dngf051] Riddle 2 solved: -1</string>
            <string>Battle f05118 won: 0</string>
            <string>Battle f05119 won: 0</string>
            <string>Battle f05118.3 won: 0</string>
            <string>Battle f05118.4 won: 0</string>
            <string>Battle f05117 won: 2</string>
            <string>Battle f05113 won: 2</string>
            <string>Battle f05115 won: 0</string>
            <string>Battle showdown won: 19</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle fight_gorah won: 9</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Fight_Whalers won: 2</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle f1081 won: 0</string>
            <string>Battle f1082 won: 0</string>
            <string>[dngf108] eatItAll: 5</string>
            <string>[dngf108] WarHelper2: 25</string>
            <string>Battle f1083a won: 0</string>
            <string>[dngf108] WarHelper1: 25</string>
            <string>Battle f1084 won: 0</string>
            <string>Battle f1086 won: 0</string>
            <string>Battle f1087 won: 0</string>
            <string>[dngf108] brave Explorer: 10</string>
            <string>Battle f1089 won: 6</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>[phexcaer] Bordell: 5</string>
            <string>Battle phex_villafight won: 1</string>
            <string>[phexcaer] Gremob: 20</string>
            <string>Battle phex_golden_temple won: 1</string>
            <string>[phexcaer] Victory over the Golden One: 20</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>[map] good Hunter: 10</string>
            <string>[map] good Hunter: 10</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>[map] good Hunter: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Battle dfinal_welcome won: 1</string>
            <string>Battle dfinal_toughbattle2 won: 1</string>
            <string>Battle dfinal_toughbattle1 won: 1</string>
            <string>Battle dfinal_toughbattle3 won: 1</string>
            <string>Battle dfinal_toughbattle4 won: 1</string>
            <string>Battle dfinal_toughbattle5 won: 1</string>
            <string>Battle dfinal_toughbattle6 won: 1</string>
            <string>Battle dfinal_toughbattle7 won: 1</string>
            <string>Battle dfinal_toughbattle8 won: 2</string>
            <string>Battle dfinal_toughbattle9 won: 2</string>
            <string>Battle dfinal_endbattle won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle liebespinnen_1 won: 1</string>
            <string>Battle liebeschrat_1 won: 0</string>
            <string>Battle liebewoelfe_1 won: 1</string>
            <string>Battle liebespinnen_2 won: 1</string>
            <string>Battle liebeschrat_2 won: 0</string>
            <string>Battle liebeschrat_3 won: 0</string>
            <string>Battle liebewoelfe_2 won: 1</string>
            <string>[dwoods1] Peacekeeper: 100</string>
            <string>[vidsand] THe Bards Tale: 50</string>
            <string>[liskor] Gave Items: 15</string>
            <string>[liskor] Final Love: 35</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Beilunk_Kampf1 won: 6</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Seereise_Piratenangriff3 won: 0</string>
            <string>[thorwal] Beilunk Helper: 75</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[rukian] Smelled Fishy Slaughterhouse: 10</string>
            <string>[rukian] Got the Slaughterhouse hint: 30</string>
            <string>[rukian] Rukian made peaceful: 30</string>
            <string>Battle rukcanni won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_skel1 won: 1</string>
            <string>Battle f_dc2_skel2 won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_ork1 won: 1</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_zom1 won: 1</string>
            <string>Battle f_dc2_zomskel won: 3</string>
            <string>Battle baernecromancer_weak won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_zom2 won: 2</string>
            <string>Battle f_dc2_ork2 won: 1</string>
            <string>[dcrypt2] Baerhag peaceful solution: 150</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>[bodon] Baerhag Axe Bringer: 50</string>
            <string>[bodon] Baerhag Finish: 100</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle tk_walk1 won: 1</string>
            <string>Battle tk_walk2 won: 1</string>
            <string>[dng_swafnir] Inquisitive: 5</string>
            <string>Battle tk_cave1 won: 1</string>
            <string>Battle tk_cave2 won: 1</string>
            <string>Battle tk_tcf1 won: 1</string>
            <string>Battle tk_tcfroom1 won: 2</string>
            <string>Battle tk_tcfroom2 won: 1</string>
            <string>Battle tk_tcf2 won: 1</string>
            <string>Battle tk_tcf3 won: 1</string>
            <string>Battle tk_tcf4 won: 1</string>
            <string>Battle tk_tcf5 won: 2</string>
            <string>[dng_swafnir] Torkils Chasm: 50</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>[map] great Hunter: 20</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle city_guards7 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle camp_town_2 won: 0</string>
          </xplog>
          <receivedwonders />
          <charsetup>
            <maintexid>0</maintexid>
            <weaptexid>-1</weaptexid>
            <id />
            <acc>
              <string>elf_female_02</string>
              <string>elf_ponnytail_01</string>
              <string>elf_boot</string>
              <string>elf_cloth_02</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>w</geschlecht>
          <klasse>
            <cclass>woodelf</cclass>
            <school>0</school>
          </klasse>
          <isCompanion>false</isCompanion>
          <campDuty />
          <magicUses>0</magicUses>
          <birthday>15</birthday>
          <longname>Jandra Falkenflug</longname>
          <shortname>Jandra</shortname>
          <charpic>elfe_04.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>null</uniqueid>
          <id>3</id>
        </PlayerCharacter>
        <PlayerCharacter>
          <attribs>
            <item key="Level">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="42" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="42" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="80" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="76" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="11" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="16" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="2535" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="10000" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="180" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="3200" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.570188165" />
            </item>
            <item key="thirst">
              <Attribute val="10" fraction="0.7105605" />
            </item>
            <item key="AG">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="38" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="38" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="10" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="aexte">
              <WeaponSkill name="aexte" value="-5" atbonus="-3" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="0" atbonus="0" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="-3" atbonus="-2" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="-4" atbonus="-2" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="10" atbonus="4" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="2" atbonus="1" />
            </item>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="1" atbonus="1" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="0" atbonus="0" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="-5" atbonus="-3" />
            </item>
          </weaponskills>
          <skills>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="-2" />
            </item>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="-3" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="12" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="12" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="0" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="-5" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="0" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="0" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="0" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="0" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="5" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="0" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="4" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="4" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="10" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="12" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="4" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="2" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="2" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="-3" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="12" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="12" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="10" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="-2" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="0" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="4" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="2" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="1" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="4" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="0" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="2" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="10" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="6" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="12" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="0" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="-2" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="-2" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="3" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="4" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="2" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="1" />
            </item>
            <item key="nautik">
              <StandardSkill name="nautik" value="-19" />
            </item>
            <item key="fischen">
              <StandardSkill name="fischen" value="-19" />
            </item>
          </skills>
          <magicskills>
            <item key="abvenenum">
              <MagicSkill value="-2" name="abvenenum" />
            </item>
            <item key="adleraug">
              <MagicSkill value="-19" name="adleraug" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="-19" name="adlerwolf" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="4" name="aeolitus" />
            </item>
            <item key="analues">
              <MagicSkill value="12" name="analues" />
            </item>
            <item key="arcano">
              <MagicSkill value="6" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="8" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="-19" name="axxeleratus" />
            </item>
            <item key="balsam">
              <MagicSkill value="12" name="balsam" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="-19" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="0" name="bannbaladin" />
            </item>
            <item key="beherrschung">
              <MagicSkill value="8" name="beherrschung" />
            </item>
            <item key="blitz">
              <MagicSkill value="12" name="blitz" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="6" name="chsteigern" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="4" name="eigenschaften" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="6" name="eisenrost" />
            </item>
            <item key="exposami">
              <MagicSkill value="-19" name="exposami" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="flimflam">
              <MagicSkill value="4" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="8" name="foramen" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="12" name="fulminictus" />
            </item>
            <item key="gardianum">
              <MagicSkill value="8" name="gardianum" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="6" name="geisterbannen" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="8" name="horriphobus" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="12" name="ignifaxius" />
            </item>
            <item key="illusionen">
              <MagicSkill value="6" name="illusionen" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="12" name="klarumpurum" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="motoricus">
              <MagicSkill value="8" name="motoricus" />
            </item>
            <item key="nekropathia">
              <MagicSkill value="8" name="nekropathia" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="10" name="odemarcanum" />
            </item>
            <item key="paralue">
              <MagicSkill value="2" name="paralue" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="8" name="penetrizzel" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="2" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="respondami">
              <MagicSkill value="10" name="respondami" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="-10" name="ruhekoerper" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="2" name="saftkraft" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="-19" name="sanftmut" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="-19" name="scharfesauge" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="-19" name="seeundfluss" />
            </item>
            <item key="sensibar">
              <MagicSkill value="0" name="sensibar" />
            </item>
            <item key="silentium">
              <MagicSkill value="-6" name="silentium" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="2" name="skelettarius" />
            </item>
            <item key="solidirid">
              <MagicSkill value="-19" name="solidirid" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="-3" name="somnigravis" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="visibili">
              <MagicSkill value="-4" name="visibili" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
            <item key="destructibo">
              <MagicSkill value="-6" name="destructibo" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>139</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>2</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>46</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>255</itemid>
                <BF>-1</BF>
                <itemrep>305</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>87</itemid>
                <BF>-1</BF>
                <itemrep>39</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>88</itemid>
                <BF>-1</BF>
                <itemrep>874</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory06">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>263</itemid>
                <BF>1</BF>
                <itemrep>580</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory07">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>36</itemid>
                <BF>-1</BF>
                <itemrep>761</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory08">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>29</itemid>
                <BF>-1</BF>
                <itemrep>952</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory09">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>70</itemid>
                <BF>-1</BF>
                <itemrep>803</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory10">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>47</itemid>
                <BF>-1</BF>
                <itemrep>305</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory11">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>31</itemid>
                <BF>-1</BF>
                <itemrep>961</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory12">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>148</itemid>
                <BF>-1</BF>
                <itemrep>211</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory13">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>223</itemid>
                <BF>-1</BF>
                <itemrep>924</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory14">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>146</itemid>
                <BF>-1</BF>
                <itemrep>910</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory15">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>155</itemid>
                <BF>-1</BF>
                <itemrep>891</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>5</count>
              </Item>
            </item>
            <item key="inventory16">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory17">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory18">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item xsi:nil="true" />
            </item>
            <item key="chest">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>79</itemid>
                <BF>-1</BF>
                <itemrep>420</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>76</itemid>
                <BF>-1</BF>
                <itemrep>640</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="head">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>268</itemid>
                <BF>-1</BF>
                <itemrep>648</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item xsi:nil="true" />
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>634</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item>
                <recognized>true</recognized>
                <level>0</level>
                <varusestype />
                <itemid>162</itemid>
                <BF>-1</BF>
                <itemrep>324</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item xsi:nil="true" />
            </item>
            <item key="shield">
              <Item xsi:nil="true" />
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>51</itemid>
                <BF>-1</BF>
                <itemrep>736</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item xsi:nil="true" />
            </item>
            <item key="weapon">
              <Item>
                <recognized>true</recognized>
                <level>4</level>
                <varusestype />
                <itemid>133</itemid>
                <BF>-1</BF>
                <itemrep>864</itemrep>
                <isMagical>true</isMagical>
                <isBroken>false</isBroken>
                <uses>1</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho05 won: 1</string>
            <string>Battle dtho14 won: 3</string>
            <string>Battle dtho20.1 won: 2</string>
            <string>Battle dtho25 won: 1</string>
            <string>[dngthorwal] Explorer: 10</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho27 won: 1</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_2 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 7</string>
            <string>Battle hq13_fight1 won: 5</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle f13101b won: 1</string>
            <string>Battle f13101a won: 6</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Doctor: 5</string>
            <string>Battle orkueberfall2 won: 7</string>
            <string>Battle f13104 won: 1</string>
            <string>Battle f13105 won: 1</string>
            <string>Battle f13106 won: 3</string>
            <string>Battle camp_road_3 won: 1</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle f13107 won: 1</string>
            <string>Battle f13108 won: 0</string>
            <string>Battle f13114a won: 5</string>
            <string>Battle f13116 won: 1</string>
            <string>Battle road_random5 won: 5</string>
            <string>Battle f13110 won: 5</string>
            <string>Battle f13111.1 won: 1</string>
            <string>Battle Seereise_Piratenangriff4 won: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Doctor: 5</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Found Map Piece: 30</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_2 won: 2</string>
            <string>Battle camp_road_6 won: 6</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle f0612 won: 0</string>
            <string>Battle f0613 won: 0</string>
            <string>Battle f0615 won: 7</string>
            <string>Battle f0616 won: 8</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>[map] Good guys: 10</string>
            <string>Found Map Piece: 30</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>[dngprem] Tunneldigger: 0</string>
            <string>[dngprem] TunnelDamaged: 0</string>
            <string>[dngprem] Tunneldigger: 0</string>
            <string>[dngprem] Tunneldigger: 0</string>
            <string>[dngprem] Tunneldigger: 0</string>
            <string>[dngprem] Tunneldigger: 0</string>
            <string>[dngprem] TunnelDamaged: 0</string>
            <string>Battle skelette won: 0</string>
            <string>Battle sordul2_barn2 won: 3</string>
            <string>[guddasun] Barn in guddasun rescued: 5</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle camp_road_5 won: 2</string>
            <string>Battle ship5 won: 0</string>
            <string>Battle ship4 won: 0</string>
            <string>Battle ship3 won: 3</string>
            <string>Battle ship9 won: 0</string>
            <string>Battle ship10 won: 1</string>
            <string>Battle ship8 won: 1</string>
            <string>Battle ship6 won: 2</string>
            <string>Battle ship18 won: 1</string>
            <string>[dngship] Marbochest Riddle: 10</string>
            <string>Battle ship12 won: 1</string>
            <string>Battle ship19 won: 1</string>
            <string>Battle ship14 won: 3</string>
            <string>Battle ship17 won: 1</string>
            <string>Battle ship23b won: 1</string>
            <string>Battle ship23a won: 4</string>
            <string>Battle ship24 won: 11</string>
            <string>Battle daemon won: 10</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[dngthorwal] Climber: 10</string>
            <string>Battle dtho50 won: 1</string>
            <string>Battle dtho48 won: 0</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>[dngthorwal] Slimey: 5</string>
            <string>Battle dtho53 won: 1</string>
            <string>[dngthorwal] Explorer: 5</string>
            <string>Battle dtho55 won: 1</string>
            <string>[dngthorwal] explorer: 10</string>
            <string>Battle dtho43 won: 0</string>
            <string>Battle dtho571 won: 2</string>
            <string>Battle dtho58 won: 6</string>
            <string>Battle dtho61 won: 2</string>
            <string>Battle dtho59 won: 1</string>
            <string>Battle dtho60 won: 5</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle orkueberfall2 won: 4</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle sordul_mine1 won: 4</string>
            <string>[rovamund] Hostages of Rovamund rescued: 5</string>
            <string>Battle camp_road_1 won: 3</string>
            <string>Battle camp_town_2 won: 6</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 1</string>
            <string>Battle camp_road_4 won: 2</string>
            <string>Battle Seereise_Piratenangriff2 won: 8</string>
            <string>Battle road_random5 won: 3</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>[dngober] Tunneldigger: 0</string>
            <string>[dngober] Tunneldigger: 0</string>
            <string>[dngober] Tunneldigger: 0</string>
            <string>Battle dobe20 won: 4</string>
            <string>Battle dobe09 won: 1</string>
            <string>Battle dobe11 won: 2</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle dobe07 won: 1</string>
            <string>Battle dobe19 won: 14</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>[dngober] Explorer Bonus: 10</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle robberscamp_less won: 2</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f07613 won: 0</string>
            <string>Battle f07607 won: 4</string>
            <string>Battle f07604 won: 0</string>
            <string>Battle f07611 won: 0</string>
            <string>Battle f07610 won: 5</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle orkueberfall2 won: 2</string>
            <string>Battle camp_road_5 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_1 won: 6</string>
            <string>Battle camp_road_1 won: 1</string>
            <string>Battle f10001 won: 1</string>
            <string>Battle f10005 won: 2</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>[dngf100] Explorer bonus: 15</string>
            <string>Battle f10012 won: 2</string>
            <string>[dngf100] Explorer: 5</string>
            <string>[dngf100] Explorer: 5</string>
            <string>Battle f10013 won: 4</string>
            <string>Found Map Piece: 30</string>
            <string>Battle camp_road_6 won: 5</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Seereise_Piratenangriff1 won: 1</string>
            <string>Battle Seereise_Piratenangriff3 won: 8</string>
            <string>Doctor: 5</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle camp_road_6 won: 2</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>[dngf129] Brave Grabber: 5</string>
            <string>Battle f12905 won: 0</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12908 won: 0</string>
            <string>[dngf129] explorer: 10</string>
            <string>[dngf129] Disarmed Trap: 10</string>
            <string>Battle fheshthot won: 11</string>
            <string>Battle f12918 won: 2</string>
            <string>[dngf129] Explorer: 5</string>
            <string>Battle f12923 won: 0</string>
            <string>Battle f12924 won: 0</string>
            <string>Battle f12925 won: 0</string>
            <string>Battle f12927 won: 3</string>
            <string>Battle f12928 won: 0</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle fpirateband won: 7</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>[dngf129] Explorer: 10</string>
            <string>Battle camp_town_2 won: 1</string>
            <string>Battle f12603 won: 5</string>
            <string>Battle f12608 won: 4</string>
            <string>Battle f12607 won: 0</string>
            <string>Battle f12609 won: 2</string>
            <string>Battle f12611 won: 2</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12613 won: 1</string>
            <string>Battle f12612 won: 1</string>
            <string>Battle f12617 won: 4</string>
            <string>Battle f12618 won: 2</string>
            <string>Battle f12620 won: 4</string>
            <string>Battle f12623 won: 1</string>
            <string>[dngf126] explorer: 10</string>
            <string>[dngf126] rescuers: 25</string>
            <string>[dngf126] Crystal Crusher: 25</string>
            <string>Battle f12625 won: 2</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle f12627 won: 3</string>
            <string>[dngf126] Nameless Crushers: 50</string>
            <string>[dngf126] explorer: 10</string>
            <string>Battle f12628 won: 3</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Found Map Piece: 30</string>
            <string>Doctor: 5</string>
            <string>Battle Daspota_Bord_Liebesgefluester won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle Daspota_Tav_LetzteRuhe won: 5</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_HakenHugo won: 0</string>
            <string>Battle Daspota_Tav_Piratenkoenig won: 6</string>
            <string>Battle Daspota_Tav_ZumHolzbein won: 5</string>
            <string>Doctor: 5</string>
            <string>Battle Daspota_Spielhaus won: 2</string>
            <string>Battle Daspota_Bord_Sonya won: 2</string>
            <string>Battle Daspota_Lagerhaus won: 1</string>
            <string>Battle Daspota_LagerhausK2 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle Daspota_Tischler won: 0</string>
            <string>Battle Daspota_Segelmacher won: 1</string>
            <string>Battle Daspota_Schmied won: 0</string>
            <string>Battle Daspota_Wachhaus3 won: 0</string>
            <string>Battle betas_Vendarr won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle Daspota_Wachhaus2K2 won: 1</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Daspota_Wachhaus1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_Wachhaus2K1 won: 0</string>
            <string>Battle Daspota_Taetowierer won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle Daspota_HausKapitaeneK1 won: 3</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle Seereise_Piratenangriff5 won: 2</string>
            <string>Battle camp_town_2 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle f09402 won: 0</string>
            <string>Battle f09405 won: 0</string>
            <string>[dngf094] discovered Trapdoor: 5</string>
            <string>[dngf094] made Trapdoor operational: 10</string>
            <string>[dngf094] stupid but brave: 5</string>
            <string>Battle f09410 won: 0</string>
            <string>Battle f09413 won: 2</string>
            <string>[dngf094] found the keys use: 10</string>
            <string>Battle f09417 won: 0</string>
            <string>[dngf094] brave Explorer: 15</string>
            <string>Battle f09422 won: 17</string>
            <string>Battle camp_road_3 won: 3</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle f04604 won: 4</string>
            <string>Battle f04606 won: 0</string>
            <string>Battle f04607 won: 1</string>
            <string>Battle f04610 won: 0</string>
            <string>Battle f04612 won: 4</string>
            <string>Battle f04613 won: 0</string>
            <string>[dngf046] stand up and fright: 15</string>
            <string>[dngf046] smart decision: 15</string>
            <string>Battle f04615 won: 0</string>
            <string>Battle f04622 won: 0</string>
            <string>Battle f04628 won: 5</string>
            <string>Battle f04626 won: 1</string>
            <string>Battle f04625 won: 1</string>
            <string>[dngf046] brave Explorer: 15</string>
            <string>Doctor: 5</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f05109 won: 1</string>
            <string>Battle f05120.2 won: 0</string>
            <string>Battle f05107 won: 0</string>
            <string>Battle f05102 won: 4</string>
            <string>Battle f05103 won: 2</string>
            <string>Battle f05104 won: 0</string>
            <string>Battle f05105 won: 0</string>
            <string>Battle f05105.4 won: 1</string>
            <string>Battle f05118 won: 4</string>
            <string>Battle f05119 won: 0</string>
            <string>Battle f05118.3 won: 0</string>
            <string>Battle f05118.4 won: 0</string>
            <string>Battle f05117 won: 0</string>
            <string>Battle f05113 won: 5</string>
            <string>Battle f05115 won: 0</string>
            <string>[dngf051] Summoned Mactans: -2</string>
            <string>Battle showdown won: 19</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 3</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle fight_gorah won: 9</string>
            <string>Battle camp_road_1 won: 5</string>
            <string>Found Map Piece: 30</string>
            <string>Battle Fight_Whalers won: 2</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_2 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle f1081 won: 0</string>
            <string>Battle f1082 won: 5</string>
            <string>[dngf108] eatItAll: 5</string>
            <string>[dngf108] WarHelper2: 25</string>
            <string>Battle f1083a won: 0</string>
            <string>[dngf108] WarHelper1: 25</string>
            <string>Battle f1084 won: 0</string>
            <string>Battle f1086 won: 0</string>
            <string>Battle f1087 won: 0</string>
            <string>[dngf108] brave Explorer: 10</string>
            <string>Battle f1089 won: 6</string>
            <string>[dngf108] language Checker: 10</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>[dngf108] Ork Knowledge: 20</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>[phexcaer] Bordell: 5</string>
            <string>Battle phex_villafight won: 1</string>
            <string>[phexcaer] Gremob: 20</string>
            <string>Battle phex_golden_temple won: 1</string>
            <string>[phexcaer] Victory over the Golden One: 20</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle orkueberfall2 won: 5</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_4 won: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall won: 2</string>
            <string>Found Map Piece: 30</string>
            <string>Battle dfinal_welcome won: 1</string>
            <string>Battle dfinal_toughbattle2 won: 1</string>
            <string>Battle dfinal_toughbattle1 won: 1</string>
            <string>Battle dfinal_toughbattle3 won: 3</string>
            <string>Battle dfinal_toughbattle4 won: 1</string>
            <string>Battle dfinal_toughbattle5 won: 1</string>
            <string>Battle dfinal_toughbattle6 won: 1</string>
            <string>Battle dfinal_toughbattle7 won: 1</string>
            <string>Battle dfinal_toughbattle8 won: 2</string>
            <string>Battle dfinal_toughbattle9 won: 2</string>
            <string>Battle dfinal_endbattle won: 6</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle liebespinnen_1 won: 1</string>
            <string>Battle liebeschrat_1 won: 0</string>
            <string>Battle liebewoelfe_1 won: 1</string>
            <string>Battle liebespinnen_2 won: 1</string>
            <string>Battle liebeschrat_2 won: 0</string>
            <string>Battle liebeschrat_3 won: 0</string>
            <string>Battle liebewoelfe_2 won: 1</string>
            <string>[dwoods1] Peacekeeper: 100</string>
            <string>[vidsand] THe Bards Tale: 50</string>
            <string>[liskor] Gave Items: 15</string>
            <string>[liskor] Final Love: 35</string>
            <string>Battle camp_road_6 won: 3</string>
            <string>Battle Beilunk_Kampf1 won: 6</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Seereise_Piratenangriff3 won: 5</string>
            <string>[thorwal] Beilunk Helper: 75</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[thorwal] Immanfans: 5</string>
            <string>[rukian] Smelled Fishy Slaughterhouse: 10</string>
            <string>[rukian] Got the Slaughterhouse hint: 30</string>
            <string>[rukian] Rukian made peaceful: 30</string>
            <string>Battle rukcanni won: 1</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>[map] Nekro-Talker: 25</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle f_dc2_skel1 won: 1</string>
            <string>Battle f_dc2_skel2 won: 2</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Doctor: 5</string>
            <string>Doctor: 5</string>
            <string>Battle f_dc2_ork1 won: 1</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle f_dc2_zom1 won: 1</string>
            <string>Battle f_dc2_zomskel won: 3</string>
            <string>Doctor: 5</string>
            <string>Battle baernecromancer_weak won: 2</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle f_dc2_zom2 won: 2</string>
            <string>Battle f_dc2_ork2 won: 1</string>
            <string>[dcrypt2] Baerhag peaceful solution: 150</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>[bodon] Baerhag Axe Bringer: 50</string>
            <string>[bodon] Baerhag Finish: 100</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle tk_walk1 won: 1</string>
            <string>Battle tk_walk2 won: 1</string>
            <string>[dng_swafnir] Inquisitive: 5</string>
            <string>Battle tk_cave1 won: 1</string>
            <string>Battle tk_cave2 won: 1</string>
            <string>Battle tk_tcf1 won: 1</string>
            <string>Battle tk_tcfroom1 won: 2</string>
            <string>Battle tk_tcfroom2 won: 1</string>
            <string>Battle tk_tcf2 won: 1</string>
            <string>Battle tk_tcf3 won: 1</string>
            <string>Battle tk_tcf4 won: 1</string>
            <string>Battle tk_tcf5 won: 2</string>
            <string>[dng_swafnir] Torkils Chasm: 50</string>
            <string>Battle road_random5 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall won: 1</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Doctor: 5</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_2 won: 0</string>
            <string>Battle camp_road_5 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_6 won: 0</string>
            <string>Battle orkueberfall2 won: 1</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle camp_road_4 won: 0</string>
            <string>Battle city_guards7 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle city_guards6 won: 1</string>
            <string>Battle camp_town_2 won: 0</string>
          </xplog>
          <receivedwonders />
          <charsetup>
            <maintexid>4</maintexid>
            <weaptexid>-1</weaptexid>
            <id />
            <acc>
              <string>Wizards_skn</string>
              <string>Wizards_head_02</string>
              <string>Wizards_hat_03</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>m</geschlecht>
          <klasse>
            <cclass>wizard</cclass>
            <school>200</school>
          </klasse>
          <isCompanion>false</isCompanion>
          <campDuty />
          <magicUses>0</magicUses>
          <birthday>4</birthday>
          <longname>Delayar Zandor</longname>
          <shortname>Delayar</shortname>
          <charpic>magier_05.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>null</uniqueid>
          <id>4</id>
        </PlayerCharacter>
      </character>
      <loc>
        <dlevel>0</dlevel>
        <coords>
          <x>157.459686</x>
          <y>2.95431113</y>
          <z>-88.7588654</z>
        </coords>
        <dungeon>thorwal</dungeon>
        <rotation>310.5475</rotation>
      </loc>
      <lastTrigger />
      <guid>4f6dedb1-d7a9-439f-833b-606cfe3ed32a</guid>
    </PartyPart>
  </partypart>
  <activeParty>0</activeParty>
  <dungeonstate>
    <item key="dngthorwal">
      <DungeonState>
        <specialstate>
          <item key="0sd1">
            <string>1</string>
          </item>
          <item key="0sd2">
            <string>1</string>
          </item>
          <item key="1sd1">
            <string>1</string>
          </item>
          <item key="1sd2">
            <string>1</string>
          </item>
          <item key="2sd1">
            <string>1</string>
          </item>
          <item key="eatstuff">
            <string>1</string>
          </item>
          <item key="extraexit">
            <string>1</string>
          </item>
          <item key="swimspoiler">
            <string>0</string>
          </item>
          <item key="map.dngthorwal_hole">
            <string>1</string>
          </item>
          <item key="welcome3">
            <string>1</string>
          </item>
          <item key="zwing_deaddwarf">
            <string>1</string>
          </item>
          <item key="zwing_deadthorwalian">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////AAAAAAD//////////////////////////////////////////////////////////////////////////////wAAAAAAAP//////////AAAAAAAAAAAAAAAAAP///yMAAADwAAAAAAD///////////+Xkf//3fami///////////AACt/////////////////wAAAAAAAPv//////4AAAAAAAAAaAAAAAAAAAP///wAAAAAAAAAAAAAAAAAA/////wAAAAC3AAAAAAD/////AAAAAAAAAAAAAAAA//////80AAAAAAAAAAAAkv///68AAAAAAAAAAAAAAAD///8AAAAAAAAAAAAAAAAAAAAA/1sAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAA//////+xAAAAAAAAAAAA2////4wAAAAAAAAAAAAAAAD//////wAAAAAAAAAAAAAAAAAA/2YAAAAAAAkAAAAAAP///////wAAAAAAAAAAAAAA//////8AAAAAAAAAAAAAjv///1AAAAAAAAAA/wAACv///////wAAAAAAAAAAAAAAAAAA//8dAAAAAAAAAAAAAP///////wAAAAAAAAAAAAAA//////8AAAAAAAAAAAAAAAAAAAAAAAAAAAD//wAAAP//////DwAAAAAAAAAAAAAAAAAA/+kAAAAAAAAAAAAAAP///////wAAAAAAAAAAAAAA5P////8AAAAAAAAAACgAAAAAAAAA5f8cAAAAaQAAAP8AAAAA////AAAAAAAAAAAA6rv//////5gA/////wAAAP///////////wD/AP//AAD//////////////zkAAAAAAAAAAAAA//8AAAAAAAAAAAAAAAAA//////////////////////////////////////////////////////////////////////////////////////////8AAAAAAAAAAAAAAAAA//////////////////////////////////////////////////////////////////////////////////////////8AAAAAOgAAABkAAAAA////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>80</X>
          <Y>38</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="eatstuff">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="1store">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_2_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_2_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="spear">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="torches">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="cleaver">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="orknose">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="ring">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_7">
            <LockableState>open</LockableState>
          </item>
          <item key="1_10">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_8">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="2_4">
            <LockableState>open</LockableState>
          </item>
          <item key="2_6">
            <LockableState>open</LockableState>
          </item>
          <item key="2_8">
            <LockableState>open</LockableState>
          </item>
          <item key="2_5">
            <LockableState>open</LockableState>
          </item>
          <item key="2_3">
            <LockableState>open</LockableState>
          </item>
          <item key="2_1">
            <LockableState>open</LockableState>
          </item>
          <item key="2_2">
            <LockableState>open</LockableState>
          </item>
          <item key="2_7">
            <LockableState>open</LockableState>
          </item>
          <item key="3_5">
            <LockableState>open</LockableState>
          </item>
          <item key="3_3">
            <LockableState>open</LockableState>
          </item>
          <item key="3_2">
            <LockableState>open</LockableState>
          </item>
          <item key="3_7">
            <LockableState>open</LockableState>
          </item>
          <item key="3_6">
            <LockableState>open</LockableState>
          </item>
          <item key="3_1">
            <LockableState>open</LockableState>
          </item>
          <item key="3_4">
            <LockableState>open</LockableState>
          </item>
          <item key="3_8">
            <LockableState>open</LockableState>
          </item>
          <item key="4_1">
            <LockableState>open</LockableState>
          </item>
          <item key="4_3">
            <LockableState>open</LockableState>
          </item>
          <item key="4_4">
            <LockableState>open</LockableState>
          </item>
          <item key="4_2">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="2_1">
            <LockableState>open</LockableState>
          </item>
          <item key="2_2">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_dtho05">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dtho14">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_eatstuff">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_equipstuff">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_phex">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_oldpart">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_rabbit">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_secretdoor1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_secretdoor2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_bathroom">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_dtho20.1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_dtho25">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_dtho27">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_endpart1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_hole">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_secretdoor1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_secretdoor2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_stew">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_store2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_store1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_traproom">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_collapsed">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_deadguy">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_dtho43">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_hole">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_holeto3">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_secretdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_skeleton">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_spear">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_torches">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_storage">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_trap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_cleaver">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_collapsed1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_collapsed2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_collapsed3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_collapsed4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_deaddwarf">
            <TriggerState>active</TriggerState>
          </item>
          <item key="3_dtho48">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_dtho50">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_dtho53">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_dtho55">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_extraexit">
            <TriggerState>active</TriggerState>
          </item>
          <item key="3_holefrom2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="3_ring">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_slimey">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_swim1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="3_swim2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="4_dtho571">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="4_dtho58">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="4_dtho59">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="4_dtho60">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="4_dtho61">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="4_darkroom">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="4_orknose">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf131">
      <DungeonState>
        <specialstate>
          <item key="leverpos">
            <string>5</string>
          </item>
          <item key="swafniractive">
            <string>0</string>
          </item>
          <item key="seenSD12">
            <string>1</string>
          </item>
          <item key="seenSD5">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>/////////9r//////43///////////////////9kALe18gA////bAAAAGv///////////////ykAAAAAAAAAKukeAAAAAC///////////////wAAAAAAAAAAAAAAAAAAAAD//////////////wAAAAAAAAAAAAAAAAAAAAD//////////////wAAAAAAAAAAAAAAAAAAAAD//////////z/j/2QANQAANgAAAAAAAAAAAAD//////////wCH/wAAAAAAwgAAAAAKAAAAAAD//////////6D//wAAAAAAmAAAAAAAAAAAAAD//////////////wAAAAAAZgAAAAAAAAAAAAD//////////////9cAAGMAGQAAAAAAAAAAAAD//////////////5cAAAAAhQAAAABaAAAAAAD//////////////wAAAAAAZGEAAAAAAAAAAAD//////////////wAAAAAAAAAAAAAAAAAAAAD//////////////4YAABsAAAAAAAAAAAAAAAD//////////////8lTgmAAAAAAAAAAAAAAAAD//////////////zkAAAAAKQAAAABnAAAAAAD//////////////zsAAAAAqAAAAABeAADDev///////////////6EAAAAjUAAAVwBVABoAHf///////////////+IADbcAAAAAAAAAAAAAAP///////////////wAAAAAAAAAAAAAAAAAAAPX//////////////wAAAAAANgAAAAAAAAAAAHz//////////////18AAAAARQAAAABoAAAAAPH//////////////1wAAAAAOQAAIgAwAAAAAMb//////////////75SACdemgUAAABuLTgxff///////////////////////6UAAEDd/////////////////////////////8cA7v//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>26</X>
          <Y>40</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_13">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_14">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_12">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_11">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_10">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_8">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_5">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_6">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_9">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_11">
            <LockableState>open</LockableState>
          </item>
          <item key="0_16">
            <LockableState>open</LockableState>
          </item>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_13">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_15">
            <LockableState>open</LockableState>
          </item>
          <item key="0_14">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_10">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_12">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_10">
            <LockableState>open</LockableState>
          </item>
          <item key="0_11">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_14">
            <LockableState>open</LockableState>
          </item>
          <item key="0_12">
            <LockableState>open</LockableState>
          </item>
          <item key="0_13">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_doship">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_f13101a">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_welcome">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13104">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13105">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13106">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13107">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13108">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13110">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13111.1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13114a">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f13116">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_lever">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_swafnir">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_sd5a">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_sd5b">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_sd9a">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_sd9b">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_sd12a">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_sd12b">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_water">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_trap1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap3">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf061">
      <DungeonState>
        <specialstate />
        <fowData>///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////s//////////////////////////////////8AAAAAAAj4////1aP/vY///////////8x3grTiAAAAAAAAAPbAJAAAAAAAANL/////fwAAAAAAACsAAAAAAAAAAAAAAAAAAABB/////w0AAAAAAAANAAAAAAAAAAAAAAAAAAAALP////8fAAAAAAAAYwAAAAAAMwAAAAAAAAAAAAD6////QwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA///////HIgAAAAAAAAAAAAAAAAAAAAAAAAAALv///////7MAAAAAAAAAAAAAAAAAAIQiAAAAAAD//////xcAAFcAAAAAAAAAAAAAkhw3AAAAAAAk/////3wAAAAAAAAAAAAAAAAAyzEAAAAAAABA//////EAAAAAAAAAAAAAAAAAAAAAAAA0FAAAGH7///9WAAAAAAAAAAAAEg4AAAAAAAAAh18AAAAAwf//hQAAAAAAAAAAAAAAAAAAAAAAABkresv//////9MAAAAAAAAAAAAAAAAAABAqAAAAAAA7///////+AAAAAAAAAAAAAAAAADurJXhOAAAAAAD//////wUAAAAAAAAAAAAAIgAAAAAAAAArAABE//////9EAAAAAAAAAAAAAAAAAAAAAAAAAAAAQf///////3wAAAAAAABY/xEAM2YZAACMAABY5P//////////WAAAJTy2/////////9z//////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>27</X>
          <Y>27</Y>
        </fowSize>
        <itemset>
          <item key="empty">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="amulet">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="silverhelmet">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="corpses">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="lantern">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="skeleton">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="deadelf">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door />
        <chest />
        <trigger>
          <item key="0_bloodtrail">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_corpses">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_crashable1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_crashable2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_deadelf">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f0612">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f0613">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f0615">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f0616">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_handonly">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_hole">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_lantern">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_riskhole">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_shit">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_silverhelmet">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_skeleton">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngprem">
      <DungeonState>
        <specialstate>
          <item key="gotlantern">
            <string>0</string>
          </item>
          <item key="shovelspoiler">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////rIHv///////////////////////////////////////FT45uAAAA/////////////////////////////7waPNX/9owAAAAAAAAAV///////////////////eEmN/////0oAAFtVAI0AAAAAAAAAAP////////////////90AAAAlv///zMAAHQAAF0AAAAAAAAAAJT//////////////0UAAAAADwsNNFUAAH8AAEgAAAAAAAAAAH3//////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGL//////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHP//////////////zQAAAAAAAAAAAAAAAMYAAAAAAAAAAAAAIz/////////////lwAAAAAAAAAAAGkAAGUBAAAAn5AAAAAAAKb/////////////MgAAAAAAAAAAAAAAAFcAAAAAb3QAAAAAAKP/////////////VAAAAAAAAAAAAAAAAAAbAAAAOQAAAAAAAJr/////////////YAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALH/////////////RQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP//////////////RQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP//////////////pQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP///////////////wAAAAAAAAAAAAAAAAAAAAAASHQAAAAAAP//////////////twAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFv//////////////bwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAXv//////////////HwAAAAANAAAAAAAAAAAAAAAAAAAAAABD////////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAX///////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEf//////////////RQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP//////////////ngAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP///////////////woAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP////////////////iAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOD/////////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAND/////////////////XAAAAAAAAAAAAAAAAAAAwmtdRQAAB////////////////////6E6UFNSWlBJXKDpRQqE/////25a5f//////////////</fowData>
        <fowSize>
          <X>35</X>
          <Y>28</Y>
        </fowSize>
        <itemset>
          <item key="deadguy1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="deadguy2">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>14</itemid>
                    <BF>3</BF>
                    <itemrep>710</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>85</itemid>
                    <BF>-1</BF>
                    <itemrep>167</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>22</itemid>
                    <BF>-1</BF>
                    <itemrep>141</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>22</itemid>
                    <BF>-1</BF>
                    <itemrep>954</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>121</itemid>
                    <BF>-1</BF>
                    <itemrep>343</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="deadguy3">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>1</itemid>
                    <BF>3</BF>
                    <itemrep>430</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>14</itemid>
                    <BF>3</BF>
                    <itemrep>556</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>22</itemid>
                    <BF>-1</BF>
                    <itemrep>927</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>85</itemid>
                    <BF>-1</BF>
                    <itemrep>932</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="storage">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="lantern">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>25</itemid>
                    <BF>-1</BF>
                    <itemrep>347</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>1</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="findmoney">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
          <item key="0_15">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_10">
            <LockableState>open</LockableState>
          </item>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_11">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_97">
            <LockableState>open</LockableState>
          </item>
          <item key="0_99">
            <LockableState>open</LockableState>
          </item>
          <item key="0_96">
            <LockableState>open</LockableState>
          </item>
          <item key="0_98">
            <LockableState>open</LockableState>
          </item>
          <item key="0_95">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest />
        <trigger>
          <item key="0_findmoney">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_buried2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_holeintheground">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_deadguy1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_crashedTunnel_96">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_crashedTunnel_95">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_deadguy2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_deadguy3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_storage">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_lantern">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_crashedTunnel_97">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_catgold">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_crashedTunnel_99">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_crashedTunnel_98">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_buried1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_skeletons">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_deadend">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngship">
      <DungeonState>
        <specialstate>
          <item key="marbospoiler">
            <string>1</string>
          </item>
          <item key="daemonfight">
            <string>1</string>
          </item>
          <item key="daemonvic">
            <string>0</string>
          </item>
          <item key="ardora">
            <string>0</string>
          </item>
          <item key="marbochest">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////5gAZAAA6v///wAA7gDx/wAAAAAA//8AAAAA/////////////5EAAAAAAAD//xIAAAAAAJIAAAAAAMoAAAAAAEz/////////////eQAAAACp//8NAAAAAABuAAAAAAA7AAAAAAAs/////////////5MAAAAAkf//AQAAAAAAcAAAAAAAEAAAAAAAY/////////////8uAAAAALP//wEAAAAAACoAAAAAAAAAAAAAAAD/////////////AAAAAABD///dAAAAAAC4AAAAABcAAAAAAAAA//////////////8AAADT///////cAP///////////xIAAAAA/////////////////wAA////////////////////////ZwAA//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8=</fowData>
        <fowSize>
          <X>36</X>
          <Y>19</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="marbochest">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="0_sabre">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="deadguy1">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>13</itemid>
                    <BF>-1</BF>
                    <itemrep>486</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>15</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>92</itemid>
                    <BF>-1</BF>
                    <itemrep>65</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="deadguy2">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>17</itemid>
                    <BF>-1</BF>
                    <itemrep>869</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>3</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>50</itemid>
                    <BF>-1</BF>
                    <itemrep>259</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>10162</itemid>
                    <BF>-1</BF>
                    <itemrep>531</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="2_amulett">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>10162</itemid>
                    <BF>-1</BF>
                    <itemrep>854</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="1_crossbow">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_15">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_11">
            <LockableState>open</LockableState>
          </item>
          <item key="1_14">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_12">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_10">
            <LockableState>open</LockableState>
          </item>
          <item key="1_13">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_7">
            <LockableState>open</LockableState>
          </item>
          <item key="1_8">
            <LockableState>open</LockableState>
          </item>
          <item key="2_1">
            <LockableState>open</LockableState>
          </item>
          <item key="2_2">
            <LockableState>open</LockableState>
          </item>
          <item key="2_3">
            <LockableState>open</LockableState>
          </item>
          <item key="3_2">
            <LockableState>open</LockableState>
          </item>
          <item key="3_1">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_3">
            <LockableState>locked</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>locked</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_sabre">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_ship10">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ship3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ship4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ship5">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ship6">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ship8">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ship9">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_crossbow">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_deadguy">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_ship12">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_ship14">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_ship17">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_ship18">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_ship19">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_deadguy">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_ship23a">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_ship23b">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_ship24">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_ardora">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="3_marbospoiler">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngober">
      <DungeonState>
        <specialstate>
          <item key="shovelspoiler">
            <string>1</string>
          </item>
          <item key="traps0">
            <string>0</string>
          </item>
          <item key="traps1">
            <string>0</string>
          </item>
          <item key="ober_hole_xp">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////66KQ/////////////////////////////////////////////////////////////////////////+BNQAAAJL/////////////////////////////////////////1Lb//////////////////////////zAAAAA3AACU//////////+OLP///////1AGAACP///////QKSgAAAAAiAAdjv///////////////////w4AAAAAAAAAdWTP/892IGY0AMrd////GQAAAAAAJTEAADsAAAAAAAAAAAAAAAD1////////////////XQAAAAAAAAAAAAAApwAAAAAAAAAAAABKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA2///////////////jAAAAAAAAAAAAAAAADgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA////////////////TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACE//////////////+SAAAAAAAAAB0AAAAAAFkAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD/y///////////////VAAAAAAAAAAAAAAAAR/+EAAAAAAAAAAC/iJYAAAAAADo9AACVAAAAACCLAAAAAAAH////////////////EQAAAAAAAJtDAAAAAAAAAAAAAAAAAAAqAAAAAAAAAAAAAM7/hgAAAAAAAAAAAAAA//////////////////9vAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAksXH0AAAAAAAAAAAC7////////////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD/////////////////////RwAAAAAAAAAAAAAAAAAAHAAAAEMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFL//////////////////////wAAAAAAAAAAAAAAAAAAAiAAANcAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADe////////////////////wwAAAAAAAAAAAAAAAAAAEAAAAP8UAAAAAAAAAAAAGgAAACQAAAAAAAAAAABh/////////////////////wAAgwAAAAAAAAAAAAAAAAAAVsf3AAAAAAAAXmEAAAAAAAATAAAAAAAAAAAH/////////////////////wAATwAAAAAAAAAsAAAAAAAAAAD/508AAAAAAAAAAAAAAAAAAAAAAAAAAACU/////////////////////xcAd1QAACkAADwpAAAAAAAAAD7/kQAAAAAAAAAAAAAAAAAAAAAALQAAAEH//////////////////////wAAAAAAABkAAAAAAAAAAAAAAC//awAAAAAAAAAAAAAAAAAAAAAAAAAAAADI////////////////////RAAAAAAAAAAAAAAAAAAAAAAAALn/kwAAAAAAAAAYAAAAAAAAAAAAAAAAAAA3/////////////////8EdAAAAAAAAAAA6AAAAAAAAADAAAG7/wAAAAAAAAE3/CAAAAAAAAAAAAAAAAAB+/////////////////zoAAAAAAAAAAAAAAAAAAAAAAAAAAE///6QAAAAAAIKCAAAAAAAAAAAAAAAAAAC4/////////////////+IAAEMAAAAAAAAAAAAAAAAAAAAAALD///8bAAAAAJsAAAAAAAAAAAAAAAAAAACS/////////////////80AABQAAAAAAFQArIAAAAB3AA4PwP//////JAAAbIIAAAAAAAAAAAAAAAAAAADT/////////////////58AAAAAAAAAcv//////4////////////////+H0/+YAAAAAAAAAALl1XsJIGZv//////////////////zUAAAAAAAB4//////////////////////////////+9PgBJrf7j/////////////////////////////+cAAAAAAAAu//////////////////////////////////////////////////////////////////////8AAAAAAAAA/////////////////////////////////////////////////////////////////////2sAAAAAABoAM////////////////////////////////////////////////////////////////////wAAAAcAAAAAAAX//////////////////////////////////////////////////////////////////wAAAAAAAAAAHwDq/////////////////////////////////////////////////////////////////wIAAAAAAA4AAADY/////////////////////////////////////////////////////////////////1oAAAAAAAAAAAA8//////////////////////////////////////////////////////////////////9rkwAAAAAAAAAAS/r///////////////////////////////////////////////////////////////////91AAAAAAAAAADC/////////////////////////////////////////////////////////////////////wAAAAAAAAAAFJ7//f///////////////////////////////////////////////////////////////8yhgAAAAAAAAAAZAFX//////////////////////////////////////////////////////////////////wAAAAAAAAAAAADn/////////////////////////////////////////////////////////////////7UAAAAAAAAAAAD/////////////////////////////////////////////////////////////////////mDl7AE/p////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>59</X>
          <Y>52</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_97">
            <LockableState>open</LockableState>
          </item>
          <item key="0_98">
            <LockableState>open</LockableState>
          </item>
          <item key="0_99">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_8">
            <LockableState>open</LockableState>
          </item>
          <item key="1_7">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_dobe07">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dobe09">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dobe11">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dobe20">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_explorerbonus">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_holegroundtrap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_remwall97">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_remwall98">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_remwall99">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_speartrap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_statingerim">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_trap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_dobe19">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_explorerbonus">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_holewall">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_illusionwall">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_illusionwallrunin">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_secretdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_statingerim">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_trap">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf076">
      <DungeonState>
        <specialstate>
          <item key="cavebear">
            <string>1</string>
          </item>
          <item key="batsviewed">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////iuMAAP///9v/////////////////////+QAAAAAAAAAAAP//////////////////////AAAAAAAAAAAA/////////////////////wAAAAAAAAAAAAD///P/////////////////wgAAAAAAAAAAAAAAAAD///////////////8AAAAAAAAAAAAAAAAAAP///////////////+YAAAAAAAAAAAAAAAAA////////////////sQAAAAAAAAAAAAAAAAD///////////////8AAAAAAAAAAAAA/wAAAP///////////////9IAAAAAAP8AAADWAAAA////////////////AAAAAAD/AAAAAP8AAP/////////////////////3lf///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>25</X>
          <Y>28</Y>
        </fowSize>
        <itemset>
          <item key="boar">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="treasure">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="junk">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door />
        <chest />
        <trigger>
          <item key="0_cavebearescape">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_bats">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_deadboar">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_deadgoblins">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_junk">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_f07604">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f07607">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f07610">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f07611">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f07613">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_cavebear">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_holeinthewall">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_halfdeadgoblin">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_treasure">
            <TriggerState>active</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf100">
      <DungeonState>
        <specialstate>
          <item key="battlesucc">
            <string>1</string>
          </item>
          <item key="welcome">
            <string>1</string>
          </item>
          <item key="bridgesseen">
            <string>5</string>
          </item>
          <item key="vialsbroken">
            <string>0</string>
          </item>
          <item key="map.collect_einbeere">
            <string>83</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>48</string>
          </item>
          <item key="map.collect_eitrige">
            <string>32</string>
          </item>
          <item key="map.collect_gulmond">
            <string>38</string>
          </item>
          <item key="map.collect_tarnele">
            <string>111</string>
          </item>
          <item key="map.collect_shurin">
            <string>15</string>
          </item>
          <item key="map.collect_belmart">
            <string>16</string>
          </item>
          <item key="map.collect_donf">
            <string>12</string>
          </item>
          <item key="map.collect_menchal">
            <string>0</string>
          </item>
          <item key="map.collect_alraune">
            <string>8</string>
          </item>
          <item key="map.collect_atmon">
            <string>0</string>
          </item>
          <item key="map.collect_ilmen">
            <string>50</string>
          </item>
          <item key="map.collect_finage">
            <string>0</string>
          </item>
          <item key="map.collect_joruga">
            <string>3</string>
          </item>
          <item key="map.collect_thonnys">
            <string>13</string>
          </item>
          <item key="map.collect_lotus">
            <string>0</string>
          </item>
          <item key="map.collect_olgin">
            <string>0</string>
          </item>
          <item key="map.collect_kairan">
            <string>0</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8AAP///////////////////////////////////////v///////////////////////////////////////////////////////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAD//////zgAAAAAAAAAfarj/////4UvE5z//////1YAAFyBAAAAAAAAAAAAAAAAAAAABf//////////////AAAAAAAAAAAAAAAAAAAAAAAAAAD////KAAAAAAAAAAAAAAAAAAAAAAAAAAAA////AAAAAAAAAAAAAAAAAAAAAAAAAAAAALX/////////////AAAAAAAAAAAAAAAAAAAAAAAAAP//////AAAAAAAAABQAAAAAAAAAAAAAANj/////////////AAAAAAAAAAAAAAAAAAAAAP//////////////AAAAAAAAAAAAAAAAAAAAAAAAAAD/////nAAAAAAAAACOAAAAAAAAAAAAAAAAZv/2UwAQAAAAAAAAAAAAAAAAAAAAAAAAAP3/////////////AAAAAAAAAAAAAAAAAAAAAAAAAAD////DAAAAAAAAO0wAAAAAAAAgAAAAAAAApPkAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAK7///////////8AAAAAAAAAAAAAAAAAAAAAAAAAAAD///81AAAAAAAAAAAAAAAAAAAAAAAAAACR/4gAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPf/////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAA////KwAAAAAAAAAAAAAAAAAAAAAAAAAA3qoAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP///////////////wAAAAAAAAAAAAAAAAAAAAAAAAD//////wAAAAAAAAAAAAAAAAAAAAAAAAAApP+HAAAAKjcAAAAAAAAAAAAAAAAAAAAAEf/////////////////////////////////////////////////////////////////////S5P//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>80</X>
          <Y>29</Y>
        </fowSize>
        <itemset>
          <item key="vial1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="vial2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="battlesuccess">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="dbg">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>13</itemid>
                    <BF>-1</BF>
                    <itemrep>112</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>10</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="chest_2_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="2_6">
            <LockableState>open</LockableState>
          </item>
          <item key="2_1">
            <LockableState>open</LockableState>
          </item>
          <item key="2_2">
            <LockableState>open</LockableState>
          </item>
          <item key="2_3">
            <LockableState>open</LockableState>
          </item>
          <item key="2_4">
            <LockableState>open</LockableState>
          </item>
          <item key="2_5">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="2_1">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_f10001_1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_f10001_2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_secretdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_welcome1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_welcome2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_welcome3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_elf">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f10005">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_vial">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_explorer1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_explorer2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_f10012">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_f10013">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_iwcheck">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_iwrunin">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_secretdoor1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_secretdoor2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_secretdoor3">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_secretdoor4">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_secretdoor5">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_teleport1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_teleport2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_vialroom">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_b1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_b2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_b3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_b4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_b5">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf129">
      <DungeonState>
        <specialstate>
          <item key="sd">
            <string>1</string>
          </item>
          <item key="t1disabled">
            <string>1</string>
          </item>
          <item key="ptdisabled">
            <string>1</string>
          </item>
          <item key="pirates">
            <string>2</string>
          </item>
          <item key="dragon">
            <string>2</string>
          </item>
          <item key="gothesh">
            <string>1</string>
          </item>
          <item key="lagerpalaver">
            <string>~23~~35~~41~</string>
          </item>
          <item key="map.collect_einbeere">
            <string>78</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////1///////////////////////////////////////////////////////////////////////////////////////////////////9oIqTwAAAACl///////////////////////////////////////////////////////////////////////////////////////////ljn8AAAAAAAAAAACZ//////////////////////////////////////////////////////////////////////////////////////////8dAAAAAAAAAAAAKen//////////////////////////7f////////////////////////////////////////////////////////////////PAAAAAOWXAAAA+/////////////////////+RBlA8AAArMileAEOUBAAANY5NAACW//////+YCXI3AGUAEzhsWZ8AAABTVHv////J//////85AAAABf+GAAAx/85dXPv//z9YAB9w3f////8AAAAAAAAAAAAAAAAIAAAAAAAAAAAAbf////9aAAAAAAAAAAAAAAAAAAAAAAAbxQAAAMr///8AAAAAC/8HAABz/wAAAHj/DgAAAAAANv////+SAAAAAAAAAAAAAAAAAAAAAAAAAAAAGP////+bAAAAAAAAAAAAADsAAAChAAAALAAAALT///+TAAAA4f8aAACK/wAAABt/AAAAAAAAvP////9LAAAAAAAAAAAAEwAAAAAAAAAAAAAABf////+GAAAAAAAAAAAAAAAAAAAWAAAAAAAAAKP/////MQAAv/8nAACs/wAAAAAAAAAADAAAo/////8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP////89AAAAAAoAAAAAAAAAAAAPAAAAAAAAAJv//+wRAAAAo/8AAABt9gAAAAAAAAAAGQAAyP////8AAAAAFBomLgAAADctOAAAAAAAAAAAAP////+SAAAADgAPAAAKAAAjAAAEtRsAAB0AAJn//0AAAAAB7f9eAAAA/y4AAAAAAAAADwAAY/////8kAAAXAAAAAAAAAAAAAAAAALoAAAAABP////+PAAAAAAAAAAAAAAAAAAAAAAAAAAAAAI///wAAAAD///8AAAAA/wcAAAAACgAAAAAArv////9HAAAAAAAAAAAAAAAAAAAAALYAAAAAif/////QAAAAAwAAAAAAAAAAAAA2AAAAAAAAAHz//0gAAACs//8PAABX/xYAAAAAAAAAAAAAx/////9OAAAAAAAAAAAAAAAANgAAAOEAAAAAfP/////0AAAAAHYAAAAABJsAAAA9EAAAEwAAAK3///+VAAAAGfUAAACv/wAAAAAAAAAAAAAAsf/////QAAAAAAAAAAAAAAAAAAAAGgAAAAAAgv/////sAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPP/////IQAAPP8AAACX/yMAAAAAAAAAAAAAu//////oAEMNAABSAAAAANTVAAAAAAAAAAAAACv////RAAAAAAYAAAAAFQAAAABWAAAAAAAAAGn/////AAAAZP9SAAAM/zMAAAAAAAAAAAAAAO3///9DAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHz/////eAJSL95TAAAbsVU2KVnWAAAAAAAAAB//////PQAAIP//AAAAnigAAAAAAAAAAAAAAJT///8bAAAAAAAPAAAAAAAAAAAAAAAAAAAAAA3///+AAAAAAAAAAAAAAAAANg0AZgAAAAAAAADb/4ohAAAAAPz2AAAAX+cAAAAAAAAAAAAAAN////8AAAAAAKswAAAAAAAAAAAAAAAAAAAAAPH//5MAABgNAAAAAAAAAAAAAAAAAA0AAAAAAFH//y0AAABM+v84AAAm//8AAAAAAAAAAAAAZv////8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOn///4PAAAAAAAAAAAAAAAAAAAAAAAAAAAAAMn//58AAACf//8PAAAt//+UAAAAAAAAAAAAA////8gAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALv///+bAAAAAAAAAAAAAAAAAAAAAAAAAH8AAP////8AAAAAGP/7AAAAAGVnAAAAAAAAAAAAAP///+0AAAA0AABJAAAZAAAAAAAAAAAAAAAAAP////8AAAAAAAAAAAA5AAAAgQAAAAAAAAAAAOz//1kAAAAAABL/HAAAAAAAAAAAAAAAAAAAAP////8SAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOr///8AAAAAAAAAAI3/XgAAMwAAAEQAAAAAALD//1MAAAAAAAD//xIAAAAAAAAAAAAAAAwAAP//////bTMAAABpfgAUAAAABgA9fAAAAAAAc//////dAAAAAAAAM///wAAAKAAJi1kAAAAAQv///+MAAAAAADT//38AAAAAAAAAAAAAAAAAov///////////////////////////+v/////////////fwAAAAAA//////vd////////////////////////6P///////6kAAAAAAAAAAAAAxv///////////////////////////////////////////4QAAAA8///////////////////////////////////////////7AAAAAAAAAABy/////////////////////////////////////////////7sATP3/////////////////////////////////////////////MwAAAAAAAACj////////////////////////////////////////////////////////////////////////////////////////////////2wAAkgAAAADz////////////////////////////////////////////////////////////////////////////////////////////////lAAAAAAAABP/////////////////////////////////////////////////////////////////////////////////////////////////zwAAAAAAACv//////////////////////////////////////////////////////////////////////////////////////////////////zYAAAAAAAD//////////////////////////////////////////////////////////////////////////////////////////////////4kAAAAAAAC8/////////////////////////////////////////////////////////////////////////////////////////////////5MAAAAAAACp/////////////////////////////////////////////////////////////////////////////////////////////////z8AAAAAAFf//////////////////////////////////////////////////////////////////////////////////////////////////wAAAAAAAAC2/////////////////////////////////////////////////////////////////////////////////////////////////zcAAAAAAAD//////////////////////////////////////////////////////////////////////////////////////////////////z4AAAAAAAAA//////////////////////////////////////////////////////////////////////////////////////////////++AAAAAAAAAAAA/////////////////////////////////////////////////////////////////////////////////////////////+AAAAAAAAA3AAAAnv//////////////////////////////////////////////////////////////////////////////////////////uggAAAAAAAAAAABl///////////////////////////////////////////////////////////////////////////////////////PwJ5WAAAAAAAAAAAAAACM//////////////////////////////////////////////////////////////////////////////+Naf///+sAAAAAAAAAEgAAAAAAAAD///////////////////////////////////////////////////////////////////////////+rVgAAAGkAAAAAAAAAAAAMAAAAAgAAAOb///////////////////////////////////////////////////////////////////////////8AAABRAAAAAAAASAAAAAAACAAAAAAF//////////////////////////////////////////////////////////////////////////////8AAAApAAAAAAEAAAAAAAAZAAYAADvr/////////////////////////////////////////////////////////////////////////////6gAAAAAAAAAAAAAAAAAAAAAAEcAIP////////////////////////////////////////////////////////////////////////////////8NAAAAAAAAAAAAAAAAFwAARgAAGP////////////////////////////////////////////////////////////////////////////////8AAAAAAAAAAAAAAAABAAAAAABM//////////////////////////////////////////////////////////////////////////////////+oAAAAAAAAAAAAAAAAABmNjtL///////////////////////////////////////////////////////////////////////////////////+sAAAAKwAAAAAAAAAA6v///////////////////////////////////////////////////////////////////////////////////////////3gAAAAATTHCxJrc///////////////////////////////////////////////////////////////////////////////////////////////j5f//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>80</X>
          <Y>65</Y>
        </fowSize>
        <itemset>
          <item key="deadguy">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="dragon">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_16">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_12">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_9">
            <LockableState>open</LockableState>
          </item>
          <item key="1_13">
            <LockableState>open</LockableState>
          </item>
          <item key="1_14">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_7">
            <LockableState>open</LockableState>
          </item>
          <item key="1_15">
            <LockableState>open</LockableState>
          </item>
          <item key="1_8">
            <LockableState>open</LockableState>
          </item>
          <item key="1_10">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_deaddwarf">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_explorerbonus1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_explorerbonus2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12905">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12908">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12918">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_heshthot">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_lever1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_rathole1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_rathole2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_wallhole">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_runtarget">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_secretdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_shrine">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_trap1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap2plate">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_f12923">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12924">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12925">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12927">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12928">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_firewall">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_lever">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_pirateband">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_dragon">
            <TriggerState>active</TriggerState>
          </item>
          <item key="2_explorer">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="2_explorer2">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf126">
      <DungeonState>
        <specialstate>
          <item key="0_g1">
            <string>1</string>
          </item>
          <item key="1_g1">
            <string>1</string>
          </item>
          <item key="0_g2">
            <string>1</string>
          </item>
          <item key="1_g2">
            <string>1</string>
          </item>
          <item key="0_g3">
            <string>1</string>
          </item>
          <item key="1_g3">
            <string>1</string>
          </item>
          <item key="0_g4">
            <string>1</string>
          </item>
          <item key="1_g4">
            <string>1</string>
          </item>
          <item key="0_g5">
            <string>1</string>
          </item>
          <item key="1_g5">
            <string>1</string>
          </item>
          <item key="0_g6">
            <string>1</string>
          </item>
          <item key="1_g6">
            <string>1</string>
          </item>
          <item key="0_g7">
            <string>1</string>
          </item>
          <item key="1_g7">
            <string>1</string>
          </item>
          <item key="0_g8">
            <string>1</string>
          </item>
          <item key="1_g8">
            <string>1</string>
          </item>
          <item key="0_g9">
            <string>1</string>
          </item>
          <item key="1_g9">
            <string>1</string>
          </item>
          <item key="0_g10">
            <string>1</string>
          </item>
          <item key="1_g10">
            <string>1</string>
          </item>
          <item key="1_g11">
            <string>1</string>
          </item>
          <item key="1_g12">
            <string>1</string>
          </item>
          <item key="1_g13">
            <string>1</string>
          </item>
          <item key="1_g14">
            <string>1</string>
          </item>
          <item key="1_g15">
            <string>1</string>
          </item>
          <item key="1_g16">
            <string>1</string>
          </item>
          <item key="1_g17">
            <string>1</string>
          </item>
          <item key="0_sd">
            <string>1</string>
          </item>
          <item key="1_sd1">
            <string>1</string>
          </item>
          <item key="1_sd2">
            <string>1</string>
          </item>
          <item key="heshthot">
            <string>0</string>
          </item>
          <item key="0trapsoff">
            <string>1</string>
          </item>
          <item key="1trapsoff">
            <string>1</string>
          </item>
          <item key="altar">
            <string>1</string>
          </item>
          <item key="standingOnLever">
            <string>0</string>
          </item>
          <item key="crystaldone">
            <string>1</string>
          </item>
          <item key="map.collect_einbeere">
            <string>60</string>
          </item>
          <item key="rescuedone">
            <string>1</string>
          </item>
          <item key="holdingLever">
            <string>0</string>
          </item>
        </specialstate>
        <fowData>///4AAAAAAAAff8EAAAAAAAAAAAAAAAAr////wAAAAAAAAAAAAAAAAAAAAAAANf3BAAD8///////9AAAAAAAAGvRAAAAAAAAAAAAAAAAALL//+QAAAAAAAAAAAAAAAAAAAAAAAAAqgAAAKT///////8AAAAAAAAQAAAAAAAAAAAADQAAAADC///nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACi///////2AAAAAAAAAAAAAAAAAAAAAAAAAAAAn////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAp///////+AAAAAAAAAAAAAAAAAAAAAAAAAAAAKz///9zJj0fAAAAXwAAAAAAAAAAAAAAAAAAACBG//////8AAAAAAAAAAAAAAAAAAAAAAAAAAAC3///nAAAAAAAAAH4AAAAAAAAAAAAAAAAAAAAAAK7////pAAAAAAAAAAAAAAAAAAAAAAAAAAAApP//5AAAAAAAAAB/AAAAAAAAAAAAlwAAAAAAAAC4////6gAAAAAAAAAAAAAAAAcAAAAAAAAAAL3//+sAACoAAAAAfQAAAAAAAAAAAJwAAAAAAwAAuP///+gAAAAAAAAAAAAAAC0qNwAAAAAAAACe///rAAAAAAAAAH7/1AAAAAAAAACTAAAAAAAAAKf////lAAAAAAAAAAAAAAAAAAAAAAAAAAAAwv//+gAACQAAAACFoAAAAAAAAAAApAAAAAAiAADB/////198PQAAAAAAAAAAAAAAAAAAAAAAAJ3//+gAAAAAAAAAhgAAAAAAAAAAAJYAAAAAAAAAvP////////8AAAAAAAAAAAAAAAAAAAAAAACv///+AAAAAAAAAAAAAAAAAAAAAACeAAAAAAAAALj//52CnpCCAAAAAAAAAAAAAKGKgIOKgoqHhv///55iAAAAAAAAAAAAdoxkgGeA/wAAAAAAaLH//+8AAAAAAAAAAAAAAAAAAACKAAAAAAAAAACp////5QAAAAAAAAAAAAAAAAAAAAUAAAAAAAAA///uAAAAAAAAAAAAAAAAAAAAhAAAAAAAAAAAv/////+ENQAAAAAAAAAAAAAAAAAAADwAAAAAAKb/7QAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALT//yYAAMAAAAAAAAAAAAAAAAAAAACoAAAAAACn//99bgAAAAAAAAAAAAAAAAAAAAAAAAAAAAC9/+UAAABwTi0ZAAAAAAAAAAAcAAAAhQAAACBF////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAvv/xAAAAAAAWAAAAAAAAAAAAAAAAAIMAAAALHP//7AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKD/5gAAAAAAAAAAAAAAAAAAAAAAAACHAAAAAACo/+8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACj/+gAAAArAAAAAAAAAAAAAAAAAAAAkgAAAAAAsv//MSQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAsP/lAAAAAAAAAAAAAAAAAAAAAAAAAJ0AAAAAAO3//z8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAL//5AAAAAAAAAAAAAAAAAAAAAAAAACoAAAAUWZLbO8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAwCk//kAAAAAAAAAAAAAAAAAAAAAAACUqQAAAAAAAAD1AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAApf/vAAAABQBnAAAAAAAAAAAAk7X//6EAAAAAAAAA/wAAAAAAAAAAAABMAAAAAAAAAAAAAAAAAMb//wAAAAAAi92pxKrGq8Ouwf/////IAAAAAAAAAA==</fowData>
        <fowSize>
          <X>54</X>
          <Y>24</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="presentring">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="statue">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>248</itemid>
                    <BF>-1</BF>
                    <itemrep>213</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_15">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_10">
            <LockableState>open</LockableState>
          </item>
          <item key="0_12">
            <LockableState>open</LockableState>
          </item>
          <item key="0_16">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_11">
            <LockableState>open</LockableState>
          </item>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_14">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_13">
            <LockableState>open</LockableState>
          </item>
          <item key="0_18">
            <LockableState>open</LockableState>
          </item>
          <item key="0_17">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_12">
            <LockableState>open</LockableState>
          </item>
          <item key="1_10">
            <LockableState>open</LockableState>
          </item>
          <item key="1_13">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_8">
            <LockableState>open</LockableState>
          </item>
          <item key="1_14">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_11">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_7">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_15">
            <LockableState>open</LockableState>
          </item>
          <item key="1_9">
            <LockableState>closed</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>locked</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_f12603">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12607">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12608">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12609">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12611">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12612">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f12613">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_fireplace">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ladder">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_leverrockdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_levertraps">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g10">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g3">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g4">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g5">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g6">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g7">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g8">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_nameless_g9">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_sd">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_shithole1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_shithole2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_washingroom">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_altar">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_crying">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12617">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12618">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12620">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12623">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12625">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12627">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f12628">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_fallpit">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_ladder">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_lever">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_levertraps">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g10">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g11">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g12">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g13">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g14">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g15">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g16">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g17">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g3">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g4">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g5">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g6">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g7">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g8">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_nameless_g9">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_sd1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_sd2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_trap1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_trap2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_trap3">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf094">
      <DungeonState>
        <specialstate>
          <item key="tddiscovered">
            <string>1</string>
          </item>
          <item key="tdoperational">
            <string>1</string>
          </item>
          <item key="gotgk">
            <string>1</string>
          </item>
          <item key="clicktrap">
            <string>1</string>
          </item>
          <item key="sleeping_room_looted">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////+eAP//////////////////////////////////////////////////////////////////////////////////pQD/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////oncAqv///+D/yf////////////////////////////8AAACEAEcArQAA7v////////////////////////8AAAAAAADwnU4AAAD/gAAA////////////////AAAAAAAAAAAAAAAAAAAAAABy////////////////////////AAAAAAAAAAAAAAAAAAAAAAD//////////////1UAAAAAAAAAAAAAAAAAAAAAAP///////////////////////wAAAAAAAAAAAAAAAAAAAAAAO/////////////8AAAAAAAAAANr////////FAAD///////////////////////9RAACS//++AAAAAACFAAAAAGD/////////////AAAAXgAAAAAA////AAAAAAD///////////////////////8AAAAAAAAAAAAIAAAAAAAAAACe/////////////2YAAAAAAACxAAAAYgYAAAAA////////////////////////AAAAAAAAAAAEAAAAAAAAAAAA/f////////////+NAAAAAAAAAD0AAACCAAAAoP///////////////////////w8AAAAAAAAAAGUAAAAAAAAAAJD/////////////NAAAAACFAAAAAAAARwAAAAAA2///////////////////////AAAAKwAAAAAAAAAAAAAAAAD//////////////yAAAAAAhwAAWgAAAACQAAAAANX/////////////////////9gAAADEAAAAAAAAAAAAAAAAA//////////////8+AAAAU18AAOYAAADNAAAAAACD//////////////////////cAAAAAAAAAAAAAAAAAAAAAAO7/////////////CAAAAAAAAAAAAAAAAAAAAAAArf//////////////////////AAAAAAAAAAAAAAAAAAAAAADX/////////////0YAAAAAhAAAAAAAowAAAAAAAP////////////////////////+yAPoAr46skMrehv//rgD/////////////////////////86WS0/8AALLGe+T//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>63</X>
          <Y>30</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="secrethole">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="shithole">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="foodstore">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="oldbooks">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="daspotatreasure">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_10">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
          <item key="0_11">
            <LockableState>open</LockableState>
          </item>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>locked</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_beer">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f09402">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f09405">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f09410">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_goldenkey">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_shithole">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_sleepingroom">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_strangefloor">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_supplyroom">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_trap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trapdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_acidtrap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_daspotatreasure">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_estorik22">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f09413">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f09417">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_thorwalerfig">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_trap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_trap2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_trapdoor">
            <TriggerState>active</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf046">
      <DungeonState>
        <specialstate>
          <item key="enteredAlchemy">
            <string>1</string>
          </item>
          <item key="sd1">
            <string>1</string>
          </item>
          <item key="sd2">
            <string>1</string>
          </item>
          <item key="sd3">
            <string>1</string>
          </item>
          <item key="sd4">
            <string>1</string>
          </item>
          <item key="sd5">
            <string>1</string>
          </item>
          <item key="sd6">
            <string>1</string>
          </item>
          <item key="paincham">
            <string>1</string>
          </item>
          <item key="apparatusdead">
            <string>1</string>
          </item>
          <item key="magcancelled">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8vAAC/AAAAAAAAAAAAAAAAAAAAALf/////////////////////////////////////////AgAAAAAAAAAAAAAAAAAAAAAAAACY///4AAAAAABu//9PAADq/////////////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAqv//xQAAAAAASv//SAAAAABZ6wAAAP////////////8vAAAAAAAAAP///40AAAAAAAAAAJf///9FAAAAAAAAAAAAAAAAAAAAAAAA8///////////tQAAAAAAAAD///9uAAAAAAAAAACj//+8AAAAAAAAAAAAAAAAAAAAAAAAADb//////////w8AAAAAAABI////bwAAAAAAAAAAnf//0QAAAAAAAAAAAAAAAAAAAAAAAABS//////////87AAAAAAAAAAAAAAAAAAAAAAAAAJz//90AAAAAAAAAAAAAAAAAAAAAAAAAR///////////FQAAAAAAAAAAAAAAAAAAAAAAAACY////AAAAAAAAAAAAAAAAAAAAAAAAADf//////////y4AAAAAAAAAAAAAAAAAAAAAAAAArv//yAAAAAAAAAAAAAAAAAAAAAAAAAD///////////9WAAAAAAAAAAAAAAAAAAAAAAAAAJb//8cAAAAAAAAAwfwAAAAAM///////////////////////////////////////////9s///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>51</X>
          <Y>24</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="deadguy">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>72</itemid>
                    <BF>-1</BF>
                    <itemrep>877</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>30</itemid>
                    <BF>-1</BF>
                    <itemrep>695</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>3</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>14</itemid>
                    <BF>3</BF>
                    <itemrep>250</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_11">
            <LockableState>open</LockableState>
          </item>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_12">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
          <item key="0_10">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_7">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_1">
            <LockableState>locked</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_coolerroom">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_deadwanderer">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f04604">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f04606">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f04607_valuesroom">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f04610">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f04612">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f04613">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_lever1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_lever2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_lookatsd3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_pentagram">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_raven">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_secretdoor1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_secretdoor2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_secretdoorspoiler">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_trap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_alchemytable">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_chainedguy">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_chamberofpain">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_chamberofpain2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f04615_4zombies">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f04622_skeletons">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f04625_magicians">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f04626_alchemist">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f04628_painmaster">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_secretdoor1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_secretdoor2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_secretdoor3">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_sphere">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf051">
      <DungeonState>
        <specialstate>
          <item key="s1">
            <string>1</string>
          </item>
          <item key="s1spoiler">
            <string>1</string>
          </item>
          <item key="s2">
            <string>1</string>
          </item>
          <item key="s2spoiler">
            <string>1</string>
          </item>
          <item key="trapsinactive">
            <string>1</string>
          </item>
          <item key="spidereggsdone">
            <string>1</string>
          </item>
          <item key="altardone">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8XHrADAAABtdwAAAAAAw///AAAAAP///2cAAAAA0v//pgAAANQAAADe//+pYQDC/////////1EAAAAAAAQAAAAAAAAAAAAA/y4AAAAAZf8bAAAAAAAAAAAAAAAAAAAAAADtlgAAAAD/////////HgAAAAAAAAAAAAAAAAAAAAAAFwAAAACO/xgAAAAAAAAAAAAAAAAAAAAAAAB2AAAAIv////////92AAAAEAAAAAAAAABfAAAAAAAAAAAAAD//AwAAAAAAAAAAAAAAAAAAAAAAAAAAAABs/////////34AAAAAAAAAAAAAAAAAAAAAAAIAAAAAPv8AAAAAAAAABwAAAAAAAAAAAAAAAAAAAAX/////////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD//wAAAAAAAACdAAAAAAAAAAAAAAAAAAAAMf////////8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAJ7/AAAAAAAAAGkAAAAAAAAAAAAAAAAAAACe/////////wAAAAA3AAAAAAAAAAAAAKb7oigAAAAArf8AAAA6AAAAAAAAAAAAAAAAAAAAAAAAAMD/////////AAAAAEQAAAAAAAAAADEAAAAAAAAAAAD//wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA3f////////8UAAAAAAAAAAAAAAAAAAAAAB8AAAAAAMz/AAAAAAAAAAAAAEoAAAAAAAAAAAAAAACj/////////y0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAd/8kAAAAAAAAAAAAAAAAAAAAAAAAAAAAALb/////////AAAAAAAAUgAAAAAAAAAAAAAAAAAAAAD/0wAAAAAAAAAAAAAAAAAADpoAAAAAAAAA1P/////////WAAAAAADBAAAAANmhr3oAAIadAPgAqf/+AAAAAAAAAABs/83JhoH////2CgAAAACO////////////////////////////////////////////////////////////////////AAAAAP//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>55</X>
          <Y>29</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_5">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_6">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_5">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_1_6">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_99">
            <LockableState>open</LockableState>
          </item>
          <item key="0_98">
            <LockableState>open</LockableState>
          </item>
          <item key="0_96">
            <LockableState>open</LockableState>
          </item>
          <item key="0_97">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
          <item key="1_99">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="1_5">
            <LockableState>open</LockableState>
          </item>
          <item key="1_4">
            <LockableState>brokenclosed</LockableState>
          </item>
          <item key="1_2">
            <LockableState>open</LockableState>
          </item>
          <item key="1_6">
            <LockableState>open</LockableState>
          </item>
          <item key="1_1">
            <LockableState>open</LockableState>
          </item>
          <item key="1_3">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_spoiler">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_checkill98a">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_checkill99a">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_checkill99b">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_checksdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_tpmactans">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_runill98">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ladder">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_checkill98b">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_runill99">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_statue1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_mactans">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_statue2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_falltrap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f05102">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f05103">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f05104">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f05105">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f05105.4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f05107">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f05109">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f05118.4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_exit">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_altar">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_spidereggs">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_tgttp">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_tgtfalltrap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_tgtladder">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_trap1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_lever">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_bonestore">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_trap2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_trap3">
            <TriggerState>active</TriggerState>
          </item>
          <item key="1_f05113">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f05115">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f05117">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f05118">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f05118.3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f05119">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="1_f05120.2">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngf108">
      <DungeonState>
        <specialstate>
          <item key="speartrap">
            <string>1</string>
          </item>
          <item key="standingOnLever">
            <string>0</string>
          </item>
          <item key="holdingLever">
            <string>0</string>
          </item>
          <item key="spoiler">
            <string>0</string>
          </item>
          <item key="langcheck">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////wAA//////8A////////////////////////////AAAAAAAAAAD///////////////////////////8AAAAAAAAAAP///////////////////////////wAAAAAAAAAA////////////////////////////AAAAAAAAAAD///////////////////////////8AAAAA/wAAAP///////////////////////////wAAAAAAAAAA////////////////////////////AAAAAAAAAAD///////////////////////////8AAAAAAAAA/////////////////////////////wAAAAAAAAAA////////////////////////////AAAAAP8AAAD///////////////////////////8AAAAAAAAAAP///////////////////////////wAAAAAAAAAA////////////////////////////AAAAAAAAAAD///////////////////////////8AAAAAAAAAAP///////////////////////////wAAAAAAAAAA////////////////////////////AAAAAAAAAAD/////////////////////////////AP8AAAAA/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>28</X>
          <Y>28</Y>
        </fowSize>
        <itemset>
          <item key="rags1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="rags2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="rags3">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>254</itemid>
                    <BF>-1</BF>
                    <itemrep>615</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>3</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="rags4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="dagger">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="alk1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="alk2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_6">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_5">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>brokenclosed</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>locked</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_alk1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_alk2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_cannon">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dagger">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f1081">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f1082">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f1084">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f1086">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f1087">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f1089">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_fireammo">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_lever">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_meal">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_secretdoor">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_shithole">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_sleeprags1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_sleeprags2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_sleeprags3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_sleeprags4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_statbraz">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_stattai">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_trap">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dngfinal">
      <DungeonState>
        <specialstate>
          <item key="tookGold">
            <string>0</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>93</string>
          </item>
          <item key="map.collect_eitrige">
            <string>47</string>
          </item>
          <item key="map.collect_gulmond">
            <string>66</string>
          </item>
          <item key="map.collect_tarnele">
            <string>175</string>
          </item>
          <item key="map.collect_shurin">
            <string>23</string>
          </item>
          <item key="map.collect_belmart">
            <string>26</string>
          </item>
          <item key="map.collect_donf">
            <string>21</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_alraune">
            <string>3</string>
          </item>
          <item key="map.collect_atmon">
            <string>2</string>
          </item>
          <item key="map.collect_ilmen">
            <string>80</string>
          </item>
          <item key="map.collect_finage">
            <string>2</string>
          </item>
          <item key="map.collect_joruga">
            <string>4</string>
          </item>
          <item key="map.collect_thonnys">
            <string>18</string>
          </item>
          <item key="map.collect_lotus">
            <string>2</string>
          </item>
          <item key="map.collect_olgin">
            <string>2</string>
          </item>
          <item key="map.collect_kairan">
            <string>3</string>
          </item>
          <item key="map.collect_einbeere">
            <string>150</string>
          </item>
          <item key="endbattleover">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////lADZ1///////////////////////////////////////////////////////////////////////////////////////////////hAAAAAP//////////////////////////////////////////////////////////////////////////////////////////////EgAAAAAAbP///////////////////////////////////////////////////////////////////////////////////////////88AAAAAAAAY8////////////////////////////////////////////////////////////////////////////////////////////+QAAAAAAF3/////////////////////////////////////////////////////////////////////////////////////////////OAAAAAAAv////////////////////////////////////////////////////////////////////////////////////////////zoAAAAAAAD//////////////////////////4OYlP/f////////////////////////////////////////////////////////////AAAAAAAA////////////////////////AAAAAAAAAF7//////////////////////////////////////////////////////////+gAAAAAAD2H//////////////////9fAAAAAAAAAAAAfv//////////////////////////////////////////////////////////CgAAAAAAAG3///////////////+HAAAAAAAAAAAAAAAAAIz///////////////////////////////////////////////////////8PAAAAAAAA////////////////AAAAAAAAAAAAAAAAAAAA//////////////////////////////////////////////////////////84AAAAIv//////////////AAAAAAAAAAAAAAAAAAAAAHn/////////////////////////////////////////////////////////AAAAAAD/////////////AAAAAAAAAAAAAAAAAAAAAABm/////////////////////////////////////////////////////////5UAAAAA/+Kl/////+T/AAAAAAAAAAAAAAAAAAAAAAAA////////////////////////////////////////////////////////////TgAAAAAAAAAAAAAAgaAAAAAAAAAAAAAAAAAAKwAAyv////////////////////////////////////////////////////////////+1AAAAAAAAAAAAAAD/AAAJAAAAAAAAAAAAAAAARP//////////////////////////////////////////////////////////////vAAAAAAAAAAAAAAAUgAAAAAAAAAAAAAAAAAAAP////////////////////////////////////////////////////////////////+CAAAAAAAAAAAAAAAcAAAAAAAAAAAAAAAAAJ7//////////////////////////////////////////////////////////////////wAKAAAAAAAASgAAAE4AAAAAAAAAAAAAAAD//////////////////////////////////////////////////////////////////7gAAAAAAAAAAAAAAAD3AAAAAAAAAAAAAAD4//////////////////////////////////////////////////////////////////8AAAAAAAAAAAAAAAAAAP/XlKGjAAAJAABh/////////////////////////////////////////////////////////////////6YAAAAAAAAAAAAAAAAAAACB/////wAAAAAA/////////////////////////////////////////////////////////////////1sAAAAAAAAAAAAAAAAAAAAAADb///8AAAAAvP////////////////////////////////////////////////////////////////9cAAAAAAAAAAAAAAAEAAAAAAAAAP//AAAAKP////////////////////////////////////////////////////////////////97AAAAEQAAAAAAAAAAAAAAAAAAAAAAysgAAP/////////////////////////////////////////////////////////////////KAAAzAAAAAAAAAAAAAAAAAAAAAAAAAAAAAID/////////////////////////////////////////////////////////////////eQAAADMAAAAAAAAAAAAAAAAAAAAAAAAAAAD/////////////////////////////////////////////////////////////////XgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACm/////////////////////////////////////////////////////////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADE//////////////////////////////////////////////////////////////////9pAAAAAAAAAAAAAAAAAAAAAAAAAOr//9D//////////////////////////////////////////////////////////////////////wAAAAAAAAAAAAAAAAAAAAAAAP/////////////////////////////////////////////////////////////////////////////8bKsAAAAAAOrv9gAAAAAAAEv/////////////////////////////////////////////////////////////////////////////////AAAAAAD///8AAAAAAADQ///////////////////////////////////////////////////////////////////////////////////CZQAA///EAAAAAGH/////////////////////////////////////////////////////////////////////////////////////////////wABM/8L///////////////////////////////////////////////////////////////////////////////////////////////+z//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8=</fowData>
        <fowSize>
          <X>75</X>
          <Y>70</Y>
        </fowSize>
        <itemset>
          <item key="dfinal_51">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_5">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_6">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_7">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_8">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_9">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_10">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_6">
            <LockableState>open</LockableState>
          </item>
          <item key="0_7">
            <LockableState>open</LockableState>
          </item>
          <item key="0_10">
            <LockableState>open</LockableState>
          </item>
          <item key="0_5">
            <LockableState>open</LockableState>
          </item>
          <item key="0_8">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_cantleave">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_dfinal_18">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dfinal_38">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dfinal_50">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_dfinal_53">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_dfinal_54">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_dfinal_9">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_endbattle">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_entrance">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_toughbattle1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle5">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle6">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle7">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle8">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_toughbattle9">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_welcome">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dwoods1">
      <DungeonState>
        <specialstate>
          <item key="wellHeal">
            <string>1</string>
          </item>
          <item key="tarnDamage">
            <string>0</string>
          </item>
          <item key="tarnDamageKnown">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////AAAAAAAAAAAAAAAAAAAAAAD///////////////////////////////////////////////////////////////////////////////////8AAAAAAAAAAAAAAAAAAAAPAAD//////////////////////////////////////////////////////////////////////////////////wAAUQAAAAAAAAAAAAAAAAAAHQD/////////////////////////////////////////////////////////////////////////////////DAAmAAAAAAAAAAAAAAAXAAAAHwD///////////////////////////////////////////////////////////////////////////////8AAAAAAAAAAAAAAAAAAAAAAAAAAAD/////////////////////////////////////////////////////////kqKKh6GJipuIm4mH/42GmwAAAAAAAAAAAAA9AAAAAAAAAAAAAAD///////////////////////////////////////////////////////8lAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAJjwAAAAAAAAAAAAAAAD//////////////////////////////////////////////////////yIAcAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOwAl//////9+AAAADAD/////////////////////////////////////3wAAxf//////////AAAuAAAAAAAEAAAAAAAAAAAAAAAAAAAAAAArACH//////94AAAAAAAD/////////////////////////////////////AAAAMAAAYZGRYx4AAAAADgAAAAAAAAAAAAAAAAAAAAAAAAAAADAAIv//////2wAAAAAAAAD/////////////////////////////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPQAA////////AAAmAAAAAAD/////////////////////////////////////0wAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7gneFgT0gRQAAAAAAACT////////cAAAAAAAAAP///////////////////////////////////////0UAAAAAFCYDAAAAAAAAAAAzhrD/////////////////79Wqh//////////dAAAAAAAAI/////////////////////////////////////////8AAAAAAAAAAAAbo///////78qqg3RLm//////////////////////////bAAAAAAAAI/////////////////////////////////////////8AAABL////1btOKAQAAAAAAAAAAAAAAAAAUrn/////////////////////AAAAAAAASf////////////////////////////////////////8AAAAA//+dAAAAAAAAAAAAAAAAAAAAAAAAAAAALoHV////////////////nAAAAAAAALT///////////////////////////////////////8AAAAAS7UAAAAAAAAAAAAAAAAAAAAAAAAAADQAAAAAK////////////////wAASAAAABH///////////////////////////////////////8uAAAAJZUAAAAAAAAAAAAAAAAAABITAAAAAAAAAAAAAP///////////////5wAAAAAAADT//////////////////////////////////////8iAAAASR8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAf//////////////8AAE4AAAAf////////////////////////////////////m0QAAAAAJwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFv////////////9kAAAAAAAA///////////////////////////////////JAAAAAAAAKQAAAAAAkIyljJOLi4zH/5+Sioqcmjc1AAAAAAAAAAD/////////////AAAhAAAA//////////////////////////////////8cAAAAAA4AMQAAAAAA/////////////////0sEAAAAAAAAAAAbAAAA////////////QQAAAAAA3f////////////////////////////////8AAAALAAAAAAAAFwAS//////86Y///////xwAAAAAAAAAAAAAAAAAAKP//////////+AAAAAAAK4jz/////////////////////////////8AAAAAAAAAAAAAAAABp////xwAAAMT//////yYAAAAAAAAAAAAAAAAAAOL//////////7wAAAAAAAAA/////////////////////////////5oAAAAAAAAAAAAAAADp//9hAAAAAAD//////+AAAAAAJgAAAAAAAAAAiFMn//////+cNCpHAAAAAAAAOv////////////////////////////+GLwAAAAAAAAAAJAD/8wAAAAAAAAD///////9EAAAAAAAAAAAAAACMUgAAJv///3EAAAAAAAAAAAAYAKX///////////////////////////////9uAAAAAAAAADiQAAAAAAAAMv//////////QT4+QENNSEBFQo9cAAAAACT/OwAAAAAAAAAAAAAAAAD///////////////////////////////+kogAAAAAAAGgAAAAAAACU/////////////////////////54AAAAEAAD/AAAAAAAAAAAAAAAAAADg/////////////////////////////0QAAAAAAAAAZgAAAAAAIAAAAAAAAAAAAAAAAAAAzP///////wAAAAAAIP//AAAAAAAAAAAAAAAAAAC1/////////////////////////////0YAUQAAAABhAAAAAAACAAAAAAAdAh4AHQAAAAAAuP//////aAAAAAAt////AAAAAAAAAAAAAAAAAACy/////////////////////////////0cAAAAAAGMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAtv//////AAAAAAD/////AAAAAAAAAAAAAAAAAADF//////////////////////3o5+T//70YFAcHrwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAuP////8pAAAAAH//////wwAAAAAAawAAAAAAAAD//////////////////////wAAAACY////////awAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAvf///8UAAAAAAP///////wAAAAAAhWwAAAAAAAD//////////////////////wAACwCW////////AAAAAHwAAAAAAAAAAAAAAAAAKAAAAAAAuf///wAAAAAAAKT//////2QAAAAA+/8AAAAAAAD9/////////////////////wAAAACV///////NAAAiAOXjAAAAAAAAAAAAAAYnAAAAAAAA/////wAAAAAAAACo/////+gAAAAAXf/IAAAAAKT//////////////////////wAAAACV//////8+AAAAEf9OAAAAAAAAAAAAADcAAAAAAACv////0AAAAAAAAAAApv////8AAAAARv//xwAAm////////////////////////wAAAACU//////8AAAAAdVAAAAAAAAAAAgAAAAAAAAAAAK7///+JAAAAAAAAAAAAAKX///8AAAAAAAD//9C1/////////////////////////5QAAAAA/////6sAAAAAQAAAAAAAAAAAAAAAAAAAAAAAzf///+4AAAAAAAAAADkAAACk//8AAAAAAAC2//////////////////////////////9EAAAAKf///zYAAAAbAAAAAAAAAAAAPAAAAAAAAACu/////ygAAAAAAAC9LQAAAAAApP+VAAAAAAAl////////////////////////////////AAAAAH///wAfAAAeAAAAAAAAAAMAAAAAAAAAALCe6P//vwAHAAAAAC7//6kAAAAAAP//AAAAAAAA////////////////////////////////wgAAAADlugAAAAAPAAAAAAAAABAAAAAAAAAAhAAAAAD/AAAAAAAAAP//zQAAAAAAAP//EQAAAAAAkv///////////////////////////////0UAAAAALQAAAAAAAAAAAAAAAAAAAAAAAAC1AAAAAABxAAAAAAAAdf/RAAAAAAAAJ///twAAAAAABf////////////////////////////////8AAAAAAAAAAABAAAAAAAAAAAAAAAAAALD/lwAmAAAAAAAAAAAA/9gAAAAANgAm/////wAAAAAAAP/////////////////////////////////fAAAAAAAAAAAAAAAAAAAAAAAAAAAAs////wEAAAAAAAAAAAC6zwAAAAA/ACb//////zEAAAAAAG7/////////////////////////////////cQAAAAAAAD3/////////5gAAAACz/////7sALgAAAAAAACbWAAAAAAAAL////////0cAEgAAAAD/////////////////////////kSIpxf///wAAAAAAAABA///////4/+YAALj///////9DAAAAAAAAANAAAAAANgAt//////+6AAAAAAAAACH///////////////////////9aAAAAcv///z0AAAAAAAAA4v+dLlYAAP/21v////////+dAAAAAAAAcQAAAAAAACb//////+cAAAAAAAAAAP////////////////////////+4AAAADv///5EAAAA5AAAA/7EAAAAyABoAav////////+TAAAAAABUAAAAAAAALf//////hAAAAAAAAAAAsv//////////////////////////AAAAAP////8AAAAAOgD/nQAAAAAAAAAAAACFzf////+TAAAAACQAAAAAAACG/9qFSUUfAAAAAAAAAAAA////////////////////////////BwAAAAD///82AAAAAAAAAAAAAAAAAAAAAAAAAAB//zUAAAAAAAAAAAAAAEz/zgAAAAAAAAAAAAAAAAAA////////////////////////////fwAAAAAC/8gAAAAAAAAAAAAAAC2KAAAAAAAAAAAAAAAAAAAAAAAAAAAALf+/AAAtAAAAAAAAAAAAAAAACM7//////////////////////////1UACwAAAAAAAAAAAAAAAAAAK////9EvAAAAAAAAAAAAAAAbJgAAAAAAQbMAAAAAAAAIEBAAAAAAAAAAAAAAAH3///////////////////////9UAAAAAAAAAAAAGR4ODww4/////////28AAAAAAAAAAIT//xwAAAAAAAAAAAAAADv////jAAAAAAAAAAAAAAAW////////////////////////UwAAAAAAAFT/////////////////////sgAAAAAAQf////8bAAAAAAAAAAAAOf///////6gAAAAAACIAAAAAtP///////////////////////1cAAAAA4v////////////////////////+WAAAAh///////JwAAAAAAAAA4////////////cwAAAAAAAAAAAP////////////////////////8AAAAA//////////////////////////9ZAAAAvP///////x4AAAAAADX///////////////86AAAAAAAAAIP///////////////////////8AAAAA//////////////////////////8qAAAA9f////////8AAAAAY///////////////////0QAAAAAAAAD///////////////////////8AAAAA//////////////////////////8AAAAA////////////LwA3//////////////////////+bAAAAAADc//////////////////////8AAAAA//////////////////////////8AAAAA/////////////6T//////////////////////8AAAAAAAABN//////////////////////8AAAAAAAAAAAAAAAAAAAD///////////8AAAAF/////////////////////////////////////wAAAAAAAAAt//////////////////////8AAAAAAAAAAAAAAAAAAAD//////////wAAAABA/////////////////////////////////////wAAAAAAAAC9//////////////////////8AAAcAAAAAAAAAAAAAAAD/////o6CeewAAAAB5/////////////////////////////////////wAAAABHAAD///////////////////////8AAAAAAAAAAAAAAAAAAAD////gAAAAAAAAAAC9/////////////////////////////////////0kAAAAAAP////////////////////////8AAAAAAAAAAAAAAAAAAAD////jAAAAAAAAAIj///////////////////////////////////////9HAE65//////////////////////////9USYpJSYhPTF1KTUpKUmz////oAAAAAAAAjf//////////////////////////////////////////////////////////////////////////////////////////////////AAAAAACJ////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>80</X>
          <Y>80</Y>
        </fowSize>
        <itemset>
          <item key="dfinal_51">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>93</itemid>
                    <BF>-1</BF>
                    <itemrep>321</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_41">
            <LockableState>open</LockableState>
          </item>
          <item key="0_21">
            <LockableState>open</LockableState>
          </item>
          <item key="0_12">
            <LockableState>open</LockableState>
          </item>
          <item key="0_11">
            <LockableState>open</LockableState>
          </item>
          <item key="0_13">
            <LockableState>open</LockableState>
          </item>
          <item key="0_14">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_r1E1baum">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r1E1baumin">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r1E1baumout">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r1E4grube">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r1fspinnen1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r1fspinnen2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r1fwaldschrat">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r1ranken">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r1riesenspinnennetz">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r1spinnennetz">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r2E3kleinequelle">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r2fwaldschrat">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r2ranken">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r3E2blume">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r3E5tuempel">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_r3fwaldschrat">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r3fwoelfe">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r4fwoelfe">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_r4riesenspinnennetz">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_E6lichtung">
            <TriggerState>active</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dcrypt2">
      <DungeonState>
        <specialstate>
          <item key="lagerpalaver">
            <string>~23~~35~~41~~11~~39~</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>94</string>
          </item>
          <item key="map.collect_einbeere">
            <string>148</string>
          </item>
          <item key="handcrush">
            <string>off</string>
          </item>
          <item key="map.collect_gulmond">
            <string>73</string>
          </item>
          <item key="map.collect_joruga">
            <string>1</string>
          </item>
          <item key="map.baernecro">
            <string>dead</string>
          </item>
          <item key="findAxe">
            <string>1</string>
          </item>
          <item key="map.collect_eitrige">
            <string>53</string>
          </item>
          <item key="map.collect_tarnele">
            <string>202</string>
          </item>
          <item key="map.collect_shurin">
            <string>27</string>
          </item>
          <item key="map.collect_belmart">
            <string>26</string>
          </item>
          <item key="map.collect_donf">
            <string>24</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_alraune">
            <string>5</string>
          </item>
          <item key="map.collect_atmon">
            <string>2</string>
          </item>
          <item key="map.collect_ilmen">
            <string>87</string>
          </item>
          <item key="map.collect_finage">
            <string>2</string>
          </item>
          <item key="map.collect_thonnys">
            <string>20</string>
          </item>
          <item key="map.collect_lotus">
            <string>2</string>
          </item>
          <item key="map.collect_olgin">
            <string>2</string>
          </item>
          <item key="map.collect_kairan">
            <string>3</string>
          </item>
          <item key="baershaman">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////9PDWBDIrdfAAAAC////////////////////////////////////////////////////////////////10AAAAAAAAAAAAAAMD/////////////////////////////////////////////////////////////rgAAAAAAAAAAAAAAAKD/////////////////////////////////////////////////////////////mwAAAAAAAAAAAAAAALH/////////////////////////////////////////////////////////////bwAAAAAAAAAAAAAAAMH/////////////////////////////////////////////////////////////lgAAAAAAAAAAAAAAAMD//////////////////////////////////////////////////////////////4NiAAAAAAAAAAAAHf/////////////////////////////////////////////////////////////////qTR7bNYgAAAAADOb//////////////////////////////////////////////////////////////////////9MAAAAAAKP//////////////////////////////////////////////////////////////////////70AAAAAAK3//////////////////////////////////////////////////////////////////////4sAAAAAALH//////////////////////////////////////////////////////////////////////70AAAAAALD//////////////////////////////////////////////////////////////////3VPjcYAAAAAAL7/////////////////////////////////////////////////////////////////LgAAACAAAAAALv3///////////////////////////////////////////////////////////////+0AAAAAAAAAAAAAKT///////////////////////////////////////////////////////////////+2AAAAAAAAAAAAAKL///////////////////////////////////////////////////////////////+7AAAAAAAAAAAAAK////////////////////////////////////////////////////////////////+yAAAAAAAAAAAAAMD///////////////////////////////////////////////////////////////+yAAAAAAAAAAAAAND///////////////////////////////////////+FFhFisUtuR9L//////+Xg5OXLAAAAAAAAAAAAN/////////////////////////////////////////8AAAAAAAAAAB72//scLwAAAAAAAAAAAAAAAAAAAMn//////////////////////////////////////7QAAAAAAAAAAABV6WgAAAAAAAAAAAAAAAAAAAAAAKX//////////////////////////////////////wYAAAAAAAAAAAAACxkAAAAAAAgAAAAAAAAAAAAAAKH//////////////////////////////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALH//////////////////////////////////////50AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAMP/n4b///////////////////////////////////QAAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAK0/AAAu//////////////////////////////////8AAAAAAA19jI8bO5IenQAAAAAAAjQAAD4AAAAAAAAAAAAA0/////////////////////////////////8AAAAAAP///////////+iez83p6f/L0gAAAAAAAAAAIQAAU/////////////////////////////////EAAAAAAPr//////////////////////wAAAAAAAAAAAAAANf////////////////////////////////8AAAAAAP3//////////////////////6AAAAAAAAAAAAAvvf////////////////////////////////8GAAAAI/////////7/4fz9XZD//9a6/1AAAAAAAAAAAABy//////////////////////////////////8FAAAAAP/////3PQ4ZAA8oAABLfQAANwAAAAAAAAAAAAB2v////////+H///////////////////////8AAAAAAP///9gnAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPz////wFwAXvP////////////////////wAAAAAALz//1wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOL///+rAAAAXf///////////////////5UAAAAAAIn//wQAAQAAKAAAAAAAADEAAAAAAAAAAAAAAAAAAOT////TAAAATf///////////////////1AAAAAAAMv//y0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP////9cAAAAAP///////////////////6kAAAAAAMT//wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAW////8YAAAAAAP///////////////////6MAAAAAAGP//ywAAAAAAAAAAAAAAAAAAAAAAAAAADYAAAAAVf///8IAAAAAZP///////////////////1EAAAAAAIT//9IMAAAAAAAAAAAAAAAAAAAVAAAAAIQAAAAAkP////8fAAAAYsWSf37c////////////tgAAAAAAAABu//+/AAAAAAAAAAAAAAAAAAAIXDVkpAAAAAAAjolcZno1AAAAaAgAAAAU2///////////TQAAAAAAAAAAHNE1AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAV//////////lAAAAAAAAAAAAAGIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOv/////////yAAAAAAAAAAAAAEcAAAAAAAAAAA8ONjgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEv//////////FwAAAAAAAAAAAFsAAAAAAAAAAPz///9zAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAN///////hP/2OgAAAAAAAAAAACEAAAAAAAAAMf//////QAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAARv////8AAAwIBoMAAJMAAAAAJAAAAAAAAABW7P//////NwAAITxSQwAAAAAAAAAAACkAAAAAAAAAAAAA6P///wAAAAAAAAANTF0tAAAAAAIAAAAAAAAt////////rzBi////sQAAAAAAAAAAAAchqnN+um86SWe1////AAD/AAAAAAAAAAAAAAAAAAAAAAAAAACX////////////////fgAAAAAAAAAAAAAA7P///////////////wAAAAAKAQAAAAAAAAAAAAAAAAAAAABT////////////////XQAAAAAAAAAAAAAAyf///////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAVf//////////////iwAAAAAAAAAAAAAA////////////////AP8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAO//////////////XQAAAAAAAAAAAAAA4P//////////////AAD/AAAAAAAAAAAAAAAAAAAAABUAAAAAADD/////////////bAAAAAAAAAAAAAAA7f///////////////wD/AAAAAAAAAACLcTQcEWMAAAAAAAAAAAD/////////////owAAAAAAAAAAAAAA9P////////////////8AAElzUYadiMn///////d2AAAAAAAAH2H/////////////6AAAAAAAAAAAAAAA////////////////////b///////////////////rS0AAABa6v//////////////eAAAAAAAAAAAAAAA1f////////////////////////////////////////+PlMv/////////////////CAAAAAAAAAAAAAAAlv/////////////////////////////////////////////////////////////4AAAAAAAACwAAAAAA4f//////////////////////////////////////////////////////////////DAAAAAAAFQAAAABT////////////////////////////////////////////////////////////////3EJQJQYhMgAAAACY//////////////////////////////////////////////////////////////////////3NAAAAAABi///////////////////////////////////////////////////////////////////////9AAAAAABT//////////////////////////////////////////////////////////////////////+QAAAAAAAG//////////////////////////////////////////////////////////////////////+jAAAAAABf///////////////////////////////////////////////////////////////////////iAAAAAADW////////////////////////////////////////////////////////////////////////dgAAABf//////////////////////////////////////////////////////////////////////////xQAABr//////////////////////////////////////////////////////////////////////////yoAAAT//////////////////////////////////////////////////////////////////////////ygAAAD//////////////////////////////////////////////////////////////////////////xYAAAz//////////////////////////////////////////////////////////////////////////xgAACj//////////////////////////////////////////////////////////////////////////xgAAAb//////////////////////////////////////////////////////////////////////////xIAAAD//////////////////////////////////////////////////////////////////////////xMAADz//////////////////////////////////////////////////////////////////////////10AAFb//////////////////////////////////////////////////////////////////////////00AAEP//////////////////////////////////////////////////////////////////////////04AADX//////////////////////////////////////////////////////////////////////////1EAADX//////////////////////////////////////////////////////////////////////////1IAAEn//////////////////////////////////////////////////////////////////////////14AAEX//////////////////////////////////////////////////////////////////////////2gAAFL///////////////////////////////////////////////////////////////////////////6Dfuz/////////////////////</fowData>
        <fowSize>
          <X>59</X>
          <Y>80</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="handcrushtrap">
            <ItemSet>
              <entry>
                <ItemEntry>
                  <price>0</price>
                  <originpc>0</originpc>
                  <originslot />
                  <item>
                    <recognized>false</recognized>
                    <level>0</level>
                    <varusestype />
                    <itemid>74</itemid>
                    <BF>-1</BF>
                    <itemrep>42</itemrep>
                    <isMagical>false</isMagical>
                    <isBroken>false</isBroken>
                    <uses>0</uses>
                    <count>1</count>
                  </item>
                  <chance>100</chance>
                </ItemEntry>
              </entry>
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_9">
            <LockableState>locked</LockableState>
          </item>
          <item key="0_1">
            <LockableState>locked</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_1">
            <LockableState>locked</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>locked</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_dungeonexit">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_entrytrap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_ork1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_ork2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_skel1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_skel2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_thieves">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_zom1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_zom2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_f_dc2_zomskel">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_handcrush">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_narrowhole_n1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_narrowhole_n2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_narrowhole_o1">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_narrowhole_o2">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_necromancer">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_sarkophag">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_orkden">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_roomoffear">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_roomoffear_door">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_thievesden_description">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_thievesden_trap">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_zombiesarko">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
    <item key="dng_swafnir">
      <DungeonState>
        <specialstate>
          <item key="tookGold">
            <string>0</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>105</string>
          </item>
          <item key="map.collect_eitrige">
            <string>53</string>
          </item>
          <item key="map.collect_gulmond">
            <string>74</string>
          </item>
          <item key="map.collect_tarnele">
            <string>203</string>
          </item>
          <item key="map.collect_shurin">
            <string>28</string>
          </item>
          <item key="map.collect_belmart">
            <string>26</string>
          </item>
          <item key="map.collect_donf">
            <string>27</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_alraune">
            <string>11</string>
          </item>
          <item key="map.collect_atmon">
            <string>2</string>
          </item>
          <item key="map.collect_ilmen">
            <string>89</string>
          </item>
          <item key="map.collect_finage">
            <string>2</string>
          </item>
          <item key="map.collect_joruga">
            <string>1</string>
          </item>
          <item key="map.collect_thonnys">
            <string>22</string>
          </item>
          <item key="map.collect_lotus">
            <string>2</string>
          </item>
          <item key="map.collect_olgin">
            <string>2</string>
          </item>
          <item key="map.collect_kairan">
            <string>3</string>
          </item>
          <item key="map.collect_einbeere">
            <string>150</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8AAP//////////////////////////////////////////////////////////////////AAAAAAAAAAAAAAA0/////////////////////////////////////////////////////wAAAAAMAAAAAAAAAP////////////////////////////////////////////////////8AAAAAAAAAAAAAAAD/////////////////////////////////////////////////////mgAAAAAAAAD/AAAA//////////////////////////////////////////////////////9MAAAAAAAA/wAAAP//////////////////////////////////////7N0AAP+3hf///////wAAAAAAAAAAAAD//////////////////////////////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAK/////////////////////////////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAv///////////////////////////////////////8AAADaAAAAADYAAAAAAAAAAAAAAF//////////////////////////////////////////AAAAAP8AAAAAAAAAAAAA////AAAA/////////////////////////////////////////wAAAAAAAAAAAAAAAAAA0v///wYAANX///////////////////////////////////////8AAAAAAAAAAAAAAAAAAP//////SwAA////////////////////////////////////////9QAAAAAAAAAA/7SgAAD///////8AAAD///////////////////////////////////////8AAAAAAAAAjQAAAAAA//////9WAAAAAP////////////////////////////////////////8AAAAAAAAAAAAAAIz///9rAAAAADf///////////////////////////////////////////8AAAAAAAAAAAAA//9rAAAAbv///////////////////////////////////////////////wAAAAD/BAAAAOWZAAAA8/////////////////////////////////////////////////////////8ZAACDAAAAAAD//////////////////////////////////////////////00AaQGhQJkxFAAAfgQAAAAA////////////////////////////////////////AABAABIAAAAAAAAAAAAAAH8AAAAAAP//////////////////////////////////////HwAAAAAAAAAAAAAAAAAAAAAAAAAA/////////////////////////////////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAP//////////////////////////////////////////AAAAAAAAAAAAAAAAACcAAAAAAAD///////////////////////////////////////////8AAAAAAAAAAAAAAACtq9GtsKS4////////////////////////////////////////////////AAUhaf//0QAF////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>51</X>
          <Y>50</Y>
        </fowSize>
        <itemset>
          <item key="chest_0_1">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_2">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_4">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
          <item key="chest_0_3">
            <ItemSet>
              <entry />
            </ItemSet>
          </item>
        </itemset>
        <door>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
        </door>
        <chest>
          <item key="0_1">
            <LockableState>open</LockableState>
          </item>
          <item key="0_2">
            <LockableState>open</LockableState>
          </item>
          <item key="0_3">
            <LockableState>open</LockableState>
          </item>
          <item key="0_4">
            <LockableState>open</LockableState>
          </item>
        </chest>
        <trigger>
          <item key="0_cave1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_cave2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_ingald">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_ingald_lookat">
            <TriggerState>active</TriggerState>
          </item>
          <item key="0_tcf1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_tcf2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_tcf3">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_tcf4">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_tcf5">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_tcfroom1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_tcfroom2">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_walk1">
            <TriggerState>inactive</TriggerState>
          </item>
          <item key="0_walk2">
            <TriggerState>inactive</TriggerState>
          </item>
        </trigger>
      </DungeonState>
    </item>
  </dungeonstate>
  <townstate>
    <item key="thorwal">
      <TownState>
        <specialstate>
          <item key="map.maraskan">
            <string>3</string>
          </item>
          <item key="bevent_triggered">
            <string>true</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>94</string>
          </item>
          <item key="map.collect_gulmond">
            <string>76</string>
          </item>
          <item key="map.collect_eitrige">
            <string>61</string>
          </item>
          <item key="map.collect_tarnele">
            <string>206</string>
          </item>
          <item key="map.collect_shurin">
            <string>30</string>
          </item>
          <item key="map.collect_belmart">
            <string>34</string>
          </item>
          <item key="map.collect_donf">
            <string>27</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_alraune">
            <string>11</string>
          </item>
          <item key="map.collect_atmon">
            <string>2</string>
          </item>
          <item key="map.collect_ilmen">
            <string>94</string>
          </item>
          <item key="map.collect_finage">
            <string>2</string>
          </item>
          <item key="map.collect_joruga">
            <string>2</string>
          </item>
          <item key="map.collect_thonnys">
            <string>25</string>
          </item>
          <item key="map.collect_lotus">
            <string>2</string>
          </item>
          <item key="map.collect_olgin">
            <string>2</string>
          </item>
          <item key="map.collect_kairan">
            <string>3</string>
          </item>
          <item key="map.collect_einbeere">
            <string>157</string>
          </item>
          <item key="thorwal_het">
            <string>1000</string>
          </item>
          <item key="zeughaus_visited">
            <string>1</string>
          </item>
          <item key="stover">
            <string>10000</string>
          </item>
          <item key="stoverlastvis">
            <string>1045</string>
          </item>
          <item key="sordul_fluchtturm">
            <string>1</string>
          </item>
          <item key="imman">
            <string>906</string>
          </item>
          <item key="miller">
            <string>1</string>
          </item>
          <item key="ugdalf">
            <string>ok</string>
          </item>
          <item key="map.hq2triggered">
            <string>1</string>
          </item>
          <item key="lunatic">
            <string>1</string>
          </item>
          <item key="map.strasse_102">
            <string>1</string>
          </item>
          <item key="ottag">
            <string>2</string>
          </item>
          <item key="ottaw">
            <string>2</string>
          </item>
          <item key="ottas">
            <string>2</string>
          </item>
          <item key="partyship_ordered">
            <string>true</string>
          </item>
          <item key="partyship_order_time">
            <string>1061.4000244140625</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////wD//////////////////////wAAAAAAAAAAAP///////////////wAAAAAAAAAAAAD//////////////wAAAAAAAAAAAAAAAP//////////AAAAAAAAAAAAAAAA////////////AAAAAAAAAAAAAAAAAP//////////AAAAAAAAAAAAAAAA////////////AAAAAAAAAAAAAAAA////////////AAAAAAAAAAAAAAD/////////////AAAAAAAAAAAAAAD/////////////AAAAAAAAAAAAAP//////////////////////4AAA////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="temple_gamestart">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="84-102">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>113.630455</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="93-99">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>113.646378</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="101-106">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>113.662193</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="95-108">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>113.66507</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_112-107">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_118-137">
            <BuildingState val1="2" val2="0" val3="378.534363">
              <time>
                <timestamp>113.751831</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_139-144">
            <BuildingState val1="2" val2="0" val3="736.3705">
              <time>
                <timestamp>113.77594</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_50-93">
            <BuildingState val1="3" val2="0" val3="115.67997">
              <time>
                <timestamp>115.67997</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_34-104">
            <BuildingState val1="3" val2="0" val3="115.6952">
              <time>
                <timestamp>115.6952</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_92-79">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_119-79">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_434">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_20-35">
            <BuildingState val1="1" val2="0" val3="117.751427">
              <time>
                <timestamp>117.74649</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_34-35">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_1022">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3329">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="52-141">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="46">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="20">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="29">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="zeughaus">
            <BuildingState val1="4" val2="1000" val3="124.303612">
              <time>
                <timestamp>124.303612</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="35-78">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_134-58">
            <BuildingState val1="9" val2="0" val3="1060.72693">
              <time>
                <timestamp>122.347626</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_151-56">
            <BuildingState val1="5" val2="0" val3="122.366554">
              <time>
                <timestamp>122.366554</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="30">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="193-102">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>122.537781</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="181-101">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>122.542809</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="198-93">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>122.546791</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="223-128">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="187-96">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>122.552376</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="36">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="190-106">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>122.5563</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_32">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="197-99">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>122.560791</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="337-93">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_199-58">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_201-32">
            <BuildingState val1="1" val2="0" val3="132.6297">
              <time>
                <timestamp>122.658569</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="31">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_212-110">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="34">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="41">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="111-122">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="129-140">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="131-111">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="33">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="201-109">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="33-62">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="43">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="35">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-6-113">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-23-94">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_200-118">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_130-132">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="4925">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_45-79">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="220-112">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="hostel_4925">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>1061.45837</timestamp>
              </time>
              <expires>
                <timestamp>1061.45837</timestamp>
              </expires>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="marketplace_193-102">
            <BuildingState val1="2" val2="0" val3="1061.39685">
              <time>
                <timestamp>0</timestamp>
              </time>
              <expires>
                <timestamp>1062</timestamp>
              </expires>
              <items>
                <entry>
                  <ItemEntry>
                    <price>187</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>60</itemid>
                      <BF>-1</BF>
                      <itemrep>693</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>75</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>485</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>157</itemid>
                      <BF>-1</BF>
                      <itemrep>651</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1734</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>63</itemid>
                      <BF>-1</BF>
                      <itemrep>847</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>45</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>5233</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>130</itemid>
                      <BF>-1</BF>
                      <itemrep>356</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>8793</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>223</itemid>
                      <BF>-1</BF>
                      <itemrep>686</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                </entry>
              </items>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="marketplace_190-106">
            <BuildingState val1="3" val2="0" val3="1061.397">
              <time>
                <timestamp>0</timestamp>
              </time>
              <expires>
                <timestamp>1062</timestamp>
              </expires>
              <items>
                <entry>
                  <ItemEntry>
                    <price>773</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>136</itemid>
                      <BF>4</BF>
                      <itemrep>581</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>989</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>8</itemid>
                      <BF>4</BF>
                      <itemrep>45</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>35</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>116</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>104</itemid>
                      <BF>6</BF>
                      <itemrep>105</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>773</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>100</itemid>
                      <BF>7</BF>
                      <itemrep>936</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1216</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>112</itemid>
                      <BF>4</BF>
                      <itemrep>450</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>993</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>1</itemid>
                      <BF>3</BF>
                      <itemrep>636</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>104</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>4</itemid>
                      <BF>4</BF>
                      <itemrep>393</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>75</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>985</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>67</itemid>
                      <BF>3</BF>
                      <itemrep>936</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>278</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>98</itemid>
                      <BF>4</BF>
                      <itemrep>252</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>35</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>5</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>10</itemid>
                      <BF>-1</BF>
                      <itemrep>800</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>52</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>48</itemid>
                      <BF>-1</BF>
                      <itemrep>995</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>520</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>96</itemid>
                      <BF>-1</BF>
                      <itemrep>35</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                </entry>
              </items>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="marketplace_198-93">
            <BuildingState val1="2" val2="0" val3="1061.39709">
              <time>
                <timestamp>0</timestamp>
              </time>
              <expires>
                <timestamp>1062</timestamp>
              </expires>
              <items>
                <entry>
                  <ItemEntry>
                    <price>109</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>25</itemid>
                      <BF>-1</BF>
                      <itemrep>73</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>1</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>124</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>39</itemid>
                      <BF>-1</BF>
                      <itemrep>139</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>2</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>23</itemid>
                      <BF>-1</BF>
                      <itemrep>504</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>85</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>3</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>28</itemid>
                      <BF>-1</BF>
                      <itemrep>750</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>13</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>92</itemid>
                      <BF>-1</BF>
                      <itemrep>925</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>28</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>38</itemid>
                      <BF>-1</BF>
                      <itemrep>683</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>2</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>70</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>87</itemid>
                      <BF>-1</BF>
                      <itemrep>270</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>30</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>180</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>26</itemid>
                      <BF>-1</BF>
                      <itemrep>698</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>326</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>73</itemid>
                      <BF>-1</BF>
                      <itemrep>212</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>783</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>93</itemid>
                      <BF>-1</BF>
                      <itemrep>56</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>35</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>796</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>255</itemid>
                      <BF>-1</BF>
                      <itemrep>511</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>70</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>2385</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>35</itemid>
                      <BF>-1</BF>
                      <itemrep>382</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                </entry>
              </items>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="marketplace_197-99">
            <BuildingState val1="2" val2="0" val3="1061.39758">
              <time>
                <timestamp>0</timestamp>
              </time>
              <expires>
                <timestamp>1062</timestamp>
              </expires>
              <items>
                <entry>
                  <ItemEntry>
                    <price>99</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>2</itemid>
                      <BF>6</BF>
                      <itemrep>640</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>480</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>6</itemid>
                      <BF>3</BF>
                      <itemrep>664</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>20</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>258</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>69</itemid>
                      <BF>5</BF>
                      <itemrep>457</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>20</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1738</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>103</itemid>
                      <BF>5</BF>
                      <itemrep>614</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>133</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>4</itemid>
                      <BF>4</BF>
                      <itemrep>598</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>75</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>938</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>16</itemid>
                      <BF>4</BF>
                      <itemrep>802</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>5</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>10</itemid>
                      <BF>-1</BF>
                      <itemrep>103</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>16</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>13</itemid>
                      <BF>-1</BF>
                      <itemrep>148</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>85</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>49</itemid>
                      <BF>-1</BF>
                      <itemrep>893</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>20</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>50</itemid>
                      <BF>-1</BF>
                      <itemrep>415</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>101</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>75</itemid>
                      <BF>-1</BF>
                      <itemrep>142</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>870</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>96</itemid>
                      <BF>-1</BF>
                      <itemrep>101</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>961</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>77</itemid>
                      <BF>-1</BF>
                      <itemrep>414</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                </entry>
              </items>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="marketplace_181-101">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <expires>
                <timestamp>1062</timestamp>
              </expires>
              <items>
                <entry>
                  <ItemEntry>
                    <price>1</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>23</itemid>
                      <BF>-1</BF>
                      <itemrep>806</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>85</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>666</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>93</itemid>
                      <BF>-1</BF>
                      <itemrep>897</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>35</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>3</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>28</itemid>
                      <BF>-1</BF>
                      <itemrep>738</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1585</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>29</itemid>
                      <BF>-1</BF>
                      <itemrep>432</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>6</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>89</itemid>
                      <BF>-1</BF>
                      <itemrep>57</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>268</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>121</itemid>
                      <BF>-1</BF>
                      <itemrep>702</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>297</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>42</itemid>
                      <BF>-1</BF>
                      <itemrep>164</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>2099</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>35</itemid>
                      <BF>-1</BF>
                      <itemrep>345</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>23</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>92</itemid>
                      <BF>-1</BF>
                      <itemrep>186</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>7393</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>74</itemid>
                      <BF>-1</BF>
                      <itemrep>181</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>35</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>3833</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>70</itemid>
                      <BF>-1</BF>
                      <itemrep>998</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>5</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>39</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>46</itemid>
                      <BF>-1</BF>
                      <itemrep>811</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>202</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>26</itemid>
                      <BF>-1</BF>
                      <itemrep>398</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>299</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>32</itemid>
                      <BF>-1</BF>
                      <itemrep>41</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>412</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>36</itemid>
                      <BF>-1</BF>
                      <itemrep>78</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                </entry>
              </items>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="marketplace_95-108">
            <BuildingState val1="3" val2="0" val3="1061.39856">
              <time>
                <timestamp>0</timestamp>
              </time>
              <expires>
                <timestamp>1062</timestamp>
              </expires>
              <items>
                <entry>
                  <ItemEntry>
                    <price>14</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>13</itemid>
                      <BF>-1</BF>
                      <itemrep>743</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1039</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>6</itemid>
                      <BF>3</BF>
                      <itemrep>795</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>20</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>93</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>4</itemid>
                      <BF>4</BF>
                      <itemrep>122</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>75</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>95</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>2</itemid>
                      <BF>6</BF>
                      <itemrep>956</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>2243</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>108</itemid>
                      <BF>4</BF>
                      <itemrep>41</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>255</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>98</itemid>
                      <BF>4</BF>
                      <itemrep>253</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>35</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>158</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>104</itemid>
                      <BF>6</BF>
                      <itemrep>206</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>683</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>17</itemid>
                      <BF>-1</BF>
                      <itemrep>294</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>320</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>99</itemid>
                      <BF>6</BF>
                      <itemrep>745</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>35</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>672</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>16</itemid>
                      <BF>4</BF>
                      <itemrep>322</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>25</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>948</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>136</itemid>
                      <BF>4</BF>
                      <itemrep>68</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>735</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>79</itemid>
                      <BF>-1</BF>
                      <itemrep>614</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>10</chance>
                  </ItemEntry>
                </entry>
              </items>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="marketplace_187-96">
            <BuildingState val1="1" val2="0" val3="1061.39856">
              <time>
                <timestamp>0</timestamp>
              </time>
              <expires>
                <timestamp>1062</timestamp>
              </expires>
              <items>
                <entry>
                  <ItemEntry>
                    <price>4</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>10</itemid>
                      <BF>-1</BF>
                      <itemrep>586</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1076</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>112</itemid>
                      <BF>4</BF>
                      <itemrep>328</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1711</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>108</itemid>
                      <BF>4</BF>
                      <itemrep>261</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>15</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>159</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>120</itemid>
                      <BF>-1</BF>
                      <itemrep>697</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>20</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>14</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>50</itemid>
                      <BF>-1</BF>
                      <itemrep>991</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>275</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>7</itemid>
                      <BF>-1</BF>
                      <itemrep>194</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>20</chance>
                  </ItemEntry>
                  <ItemEntry>
                    <price>1427</price>
                    <originpc>0</originpc>
                    <originslot />
                    <item>
                      <recognized>false</recognized>
                      <level>0</level>
                      <varusestype />
                      <itemid>96</itemid>
                      <BF>-1</BF>
                      <itemrep>336</itemrep>
                      <isMagical>false</isMagical>
                      <isBroken>false</isBroken>
                      <uses>0</uses>
                      <count>1</count>
                    </item>
                    <chance>50</chance>
                  </ItemEntry>
                </entry>
              </items>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="vaermhag">
      <TownState>
        <specialstate>
          <item key="map.collect_wirselkraut">
            <string>77</string>
          </item>
          <item key="map.collect_eitrige">
            <string>33</string>
          </item>
          <item key="map.collect_gulmond">
            <string>51</string>
          </item>
          <item key="map.collect_tarnele">
            <string>136</string>
          </item>
          <item key="map.collect_shurin">
            <string>14</string>
          </item>
          <item key="map.collect_belmart">
            <string>17</string>
          </item>
          <item key="map.collect_donf">
            <string>11</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_alraune">
            <string>4</string>
          </item>
          <item key="map.collect_atmon">
            <string>2</string>
          </item>
          <item key="map.collect_ilmen">
            <string>66</string>
          </item>
          <item key="map.collect_finage">
            <string>2</string>
          </item>
          <item key="map.collect_joruga">
            <string>3</string>
          </item>
          <item key="map.collect_thonnys">
            <string>13</string>
          </item>
          <item key="map.collect_lotus">
            <string>2</string>
          </item>
          <item key="map.collect_olgin">
            <string>2</string>
          </item>
          <item key="map.collect_kairan">
            <string>2</string>
          </item>
          <item key="map.collect_einbeere">
            <string>107</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////8AAP////////8AAAD//////////wD/////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>9</X>
          <Y>11</Y>
        </fowSize>
        <bldstate>
          <item key="51-98">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_35">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_36">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_78">
            <BuildingState val1="4" val2="0" val3="1060.37744">
              <time>
                <timestamp>135.769073</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="29-47">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_77">
            <BuildingState val1="2" val2="0" val3="734.3373">
              <time>
                <timestamp>135.796432</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_51">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="varnheim">
      <TownState>
        <specialstate>
          <item key="map.borbarads_zeugen">
            <string>1</string>
          </item>
          <item key="map.hq12_praios">
            <string>141</string>
          </item>
          <item key="map.swafnild">
            <string>0</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>58</string>
          </item>
        </specialstate>
        <fowData>///////////////////////////////////////////////////////////////////////////////////////////////////////////////r6+////////////////////+RAAAAAP//////////////////2gYAAAD///////////////////8AAAAAMf//////////////////AAAAAAD//////////////////wAAAAAA////////////////lAAAAAAAK///////////////cQAAAAAAAI7////////////////Htc+5aQCr////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>18</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="15-30">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="78-70">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_74">
            <BuildingState val1="4" val2="0" val3="675.7823">
              <time>
                <timestamp>140.749954</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_76">
            <BuildingState val1="9" val2="0" val3="675.7808">
              <time>
                <timestamp>139.510452</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_75">
            <BuildingState val1="1" val2="0" val3="675.781">
              <time>
                <timestamp>139.593933</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_73">
            <BuildingState val1="3" val2="0" val3="675.78064">
              <time>
                <timestamp>139.6037</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="64-148">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_50">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_34">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="18-48">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="9">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="42-28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="55-81">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>601.7108</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="55-87">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>601.71106</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="54-94">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>601.711365</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="55-76">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>601.711548</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="harbor_booked_thorwal-varnheim">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="auplog">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////Yf///////////////wAAm/////////////8AAAD/////////////5QAAAP////////////8AAAD/////////////AAAA///////////////J//////////////////////////////////////////////////////////////////////////////////////////////////////////////8=</fowData>
        <fowSize>
          <X>12</X>
          <Y>16</Y>
        </fowSize>
        <bldstate>
          <item key="79-21">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="99-50">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_19">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="19-131">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="vilnheim">
      <TownState>
        <specialstate>
          <item key="map.hq13_triggered">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8A////////////////////AAAAAP////////////////8AAAAA/////////////////wAAAAD/////////////////AAAAAP////////////////8AAAAA/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>16</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="14-16">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_9">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_8">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="103-36">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="108-116">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_18">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_20">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3-82">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_17">
            <BuildingState val1="1" val2="0" val3="150.480316">
              <time>
                <timestamp>150.480316</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_22">
            <BuildingState val1="5" val2="0" val3="933.4678">
              <time>
                <timestamp>150.511642</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_19">
            <BuildingState val1="3" val2="0" val3="933.468">
              <time>
                <timestamp>151.362762</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="22-141">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="11-78">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="41-58">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>153.31218</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="36-53">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>153.317215</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="34-48">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>153.328568</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="46-55">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>153.334137</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="hostel_21">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="14-128">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="oberorken">
      <TownState>
        <specialstate>
          <item key="map.strasse_101">
            <string>1</string>
          </item>
          <item key="map.randomstreettextsdone">
            <string>123,137</string>
          </item>
          <item key="map.collect_einbeere">
            <string>80</string>
          </item>
          <item key="map.collect_tarnele">
            <string>92</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8AAAD///////////////////////8AAAAA/////////////////////wAAAAAAuf///////////////////wAAAAAA/////////////////////wAAAAAA/////////////////////wAAAAAA//////////////////////8AAAD/////////////////////////8///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="56-4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_22">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_10">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="29-60">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>155.686142</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_27">
            <BuildingState val1="4" val2="0" val3="156.654266">
              <time>
                <timestamp>156.654266</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="29-65">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>155.690414</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="39-175">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="31-71">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>155.694687</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_16">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="33-77">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>155.6993</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_11">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_28">
            <BuildingState val1="1" val2="0" val3="473.362549">
              <time>
                <timestamp>155.718857</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_25">
            <BuildingState val1="2" val2="0" val3="824.5838">
              <time>
                <timestamp>155.731232</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_23">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_30">
            <BuildingState val1="4" val2="0" val3="469.3109">
              <time>
                <timestamp>156.705414</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_26">
            <BuildingState val1="5" val2="0" val3="470.695526">
              <time>
                <timestamp>158.548141</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="127-127">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_24">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="mineoberorken">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_15">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="felsteyn">
      <TownState>
        <specialstate>
          <item key="olgardssonfirsthint">
            <string>1</string>
          </item>
          <item key="olgardssonsecondhint">
            <string>8</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8AAAD///////////////////////8AAAAA//////////////////////8AAAAAAAD///////////////////8AAAAAAAD/////////////////////AAD/AAD7////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="30-140">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="67-60">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_26">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_14">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="50-35">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_33">
            <BuildingState val1="1" val2="0" val3="857.5943">
              <time>
                <timestamp>163.39743</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_27">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="158-22">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="felsteyncastle">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="7-110">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="64-95">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="5">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="brendhil">
      <TownState>
        <specialstate />
        <fowData>/////////////////////////////////////////////////////wD//////////wAA/////////wAA////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>8</X>
          <Y>11</Y>
        </fowSize>
        <bldstate>
          <item key="2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="69-75">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_8">
            <BuildingState val1="1" val2="0" val3="188.598709">
              <time>
                <timestamp>188.598709</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="15">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="61">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="manrin">
      <TownState>
        <specialstate>
          <item key="map.saying4">
            <string>true</string>
          </item>
          <item key="map.saying5">
            <string>true</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8AAP////////////////////////8AAP///////////////////6oAAAAAAIT//////////////////wAAAAAAAAD//////////////////wAAAAAAAAD//////////////////wAAAAAAAIP////////////////////agwAAyv/////////////////////////b////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="73-33">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_86">
            <BuildingState val1="2" val2="0" val3="896.5024">
              <time>
                <timestamp>196.769562</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_88">
            <BuildingState val1="3" val2="0" val3="896.5026">
              <time>
                <timestamp>196.785126</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_87">
            <BuildingState val1="2" val2="0" val3="896.501465">
              <time>
                <timestamp>197.54483</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_54">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="17-111">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_85">
            <BuildingState val1="4" val2="0" val3="896.501953">
              <time>
                <timestamp>197.69455</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_55">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="harbor_booked_manrin-overthorn">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_40">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="hjalsing">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////VABm/////////////////////4wAAACH////////////////////AAAAAAAARP3///////////////8AAAAAAAAANf///////////////48AAAAAAAAa////////////////hwAAAAAAANH///////////////+wAAAAAAD/////////////////////AAAAAP////////////////////8AAABV//////////////////////8A5P//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>19</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_50">
            <BuildingState val1="3" val2="0" val3="220.777817">
              <time>
                <timestamp>220.777817</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_51">
            <BuildingState val1="3" val2="0" val3="220.791061">
              <time>
                <timestamp>220.791061</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_26">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_22">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="14">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="rovik">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w/////////////////////////+kAAD9/////////////////////7kAAAAAX////////////////////wAAAAAAANf/////////////////bgAAAAAAAEX/////////////////AAAAAAAAAAD/////////////////AAAAAAAAAAD///////////////8AAAAAAAAAAAD////////////////YAAAAAAAAAFD//////////////////wAAAAAAAP////////////////////8AAAAA////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="85-100">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_25">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="88-90">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>226.5314</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="100-86">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>226.535736</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="93-87">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>226.542526</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="106-82">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>226.5479</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="overthorn">
      <TownState>
        <specialstate>
          <item key="map.saying3">
            <string>true</string>
          </item>
        </specialstate>
        <fowData>///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////Tv8X//////////////////////zcAAAAASQD//////////////////9kAAAAAAAD///////////////////8AAAAAAADr/////////////////wAAAAAAAAAA////////////////1gAAAAAAAAAA/////////////////////wAAAABa/////////////////////7UAogB9////////////////////////qgB9////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="harbor_booked_rovik-overthorn">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_37">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_36">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_21">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_49">
            <BuildingState val1="6" val2="0" val3="894.367554">
              <time>
                <timestamp>229.707962</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="30-88">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_48">
            <BuildingState val1="3" val2="0" val3="894.3672">
              <time>
                <timestamp>230.647339</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="hostel_39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_23">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="128-58">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_24">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="tjanset">
      <TownState>
        <specialstate>
          <item key="map.collect_wirselkraut">
            <string>6</string>
          </item>
          <item key="map.collect_eitrige">
            <string>7</string>
          </item>
          <item key="map.collect_gulmond">
            <string>11</string>
          </item>
          <item key="map.collect_tarnele">
            <string>22</string>
          </item>
          <item key="map.collect_shurin">
            <string>1</string>
          </item>
          <item key="map.collect_donf">
            <string>1</string>
          </item>
          <item key="map.collect_alraune">
            <string>1</string>
          </item>
          <item key="map.collect_ilmen">
            <string>6</string>
          </item>
          <item key="map.collect_thonnys">
            <string>2</string>
          </item>
          <item key="map.collect_einbeere">
            <string>12</string>
          </item>
          <item key="map.collect_belmart">
            <string>0</string>
          </item>
          <item key="map.collect_menchal">
            <string>0</string>
          </item>
          <item key="map.collect_atmon">
            <string>0</string>
          </item>
          <item key="map.collect_finage">
            <string>0</string>
          </item>
          <item key="map.collect_joruga">
            <string>0</string>
          </item>
          <item key="map.collect_lotus">
            <string>0</string>
          </item>
          <item key="map.collect_olgin">
            <string>0</string>
          </item>
          <item key="map.collect_kairan">
            <string>0</string>
          </item>
          <item key="map.saying2">
            <string>true</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////AAD/////////////////////AAAAAP////////////////////8AAAD/////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>17</X>
          <Y>12</Y>
        </fowSize>
        <bldstate>
          <item key="3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_18">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_43">
            <BuildingState val1="3" val2="0" val3="234.628067">
              <time>
                <timestamp>234.628067</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="133-21">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_34">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="22-80">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_42">
            <BuildingState val1="3" val2="0" val3="262.750153">
              <time>
                <timestamp>235.555557</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_21">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="liskor">
      <TownState>
        <specialstate />
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////0AAAAA////////////////////cgAAAAAAAP//////////////1z6pAAAAAAAAAP//////////////AAAAAAAAAAD/////////////////kwCjAAAAAAD////////////////////ZAAAAAAD/////////////////////e3T/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>18</Y>
        </fowSize>
        <bldstate>
          <item key="4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_33">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_39">
            <BuildingState val1="1" val2="0" val3="523.4524">
              <time>
                <timestamp>236.570541</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="2-58">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-18-46">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_32">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_38">
            <BuildingState val1="1" val2="0" val3="523.4525">
              <time>
                <timestamp>237.547958</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="139-88">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_40">
            <BuildingState val1="4" val2="0" val3="523.452759">
              <time>
                <timestamp>238.660141</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="75-67">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="106-36">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="vidsand">
      <TownState>
        <specialstate>
          <item key="toldstories">
            <string>nl,deadship,dragon</string>
          </item>
          <item key="vidsand.toldstories">
            <string>nl,deadship,dragon</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////7b//////////////////2dtAACL////////////////AAAAAAAAy///////////////AAAAAAAA/////////////////wAAAAAA//////////////////8AAAD/////////////////////vf//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>17</X>
          <Y>16</Y>
        </fowSize>
        <bldstate>
          <item key="2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_81">
            <BuildingState val1="4" val2="0" val3="239.616409">
              <time>
                <timestamp>239.616409</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_36">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_53">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_82">
            <BuildingState val1="5" val2="0" val3="240.783173">
              <time>
                <timestamp>240.783173</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_37">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_83">
            <BuildingState val1="4" val2="0" val3="240.812729">
              <time>
                <timestamp>240.812729</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="86-103">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="6">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="thoss">
      <TownState>
        <specialstate>
          <item key="map.strasse_99">
            <string>1</string>
          </item>
          <item key="map.saying1">
            <string>true</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////8AAAD//////////////wAAAOD///////////8AAAAA1v////////////+fAADO//////////////////////////////////////////////////////////////////////////////////////////////////8=</fowData>
        <fowSize>
          <X>13</X>
          <Y>12</Y>
        </fowSize>
        <bldstate>
          <item key="97-20">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="22-48">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="104-91">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_17">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_0">
            <BuildingState val1="3" val2="0" val3="889.470337">
              <time>
                <timestamp>254.702942</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="ala">
      <TownState>
        <specialstate>
          <item key="map.collect_wirselkraut">
            <string>5</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////8AAAAA//////////////////8AAAAAAP//////////////////AP///////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>16</X>
          <Y>10</Y>
        </fowSize>
        <bldstate>
          <item key="31-79">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="80-56">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_44">
            <BuildingState val1="3" val2="0" val3="266.723083">
              <time>
                <timestamp>260.479645</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="hostel_36">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="orvil">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////rABh/////////////////////9QAAAAA/////////////////////wAAAAAA/////////////////////wAAAACPlQAA////////////////AAAAAAAAAABz///////////////OAAAAAAAAAAD/////////////////AAAAAAAAAA3/////////////////////dQBvhf///////////////////////47/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="-26-27">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_20">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="474">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="5">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_8">
            <BuildingState val1="8" val2="0" val3="713.514">
              <time>
                <timestamp>273.401672</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="35-19">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_19">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_35">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_45">
            <BuildingState val1="1" val2="0" val3="713.5142">
              <time>
                <timestamp>274.341431</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_7">
            <BuildingState val1="2" val2="0" val3="713.5144">
              <time>
                <timestamp>274.341949</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="110-77">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="ottarje">
      <TownState>
        <specialstate>
          <item key="map.strasse_100">
            <string>1</string>
          </item>
          <item key="map.collect_tarnele">
            <string>131</string>
          </item>
          <item key="map.collect_einbeere">
            <string>92</string>
          </item>
          <item key="map.collect_shurin">
            <string>14</string>
          </item>
          <item key="map.collect_alraune">
            <string>6</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>69</string>
          </item>
          <item key="map.collect_donf">
            <string>12</string>
          </item>
          <item key="map.collect_belmart">
            <string>17</string>
          </item>
          <item key="map.collect_joruga">
            <string>2</string>
          </item>
          <item key="map.collect_eitrige">
            <string>33</string>
          </item>
          <item key="map.collect_gulmond">
            <string>49</string>
          </item>
          <item key="map.collect_menchal">
            <string>0</string>
          </item>
          <item key="map.collect_atmon">
            <string>0</string>
          </item>
          <item key="map.collect_ilmen">
            <string>58</string>
          </item>
          <item key="map.collect_finage">
            <string>0</string>
          </item>
          <item key="map.collect_thonnys">
            <string>13</string>
          </item>
          <item key="map.collect_lotus">
            <string>0</string>
          </item>
          <item key="map.collect_olgin">
            <string>0</string>
          </item>
          <item key="map.collect_kairan">
            <string>0</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////+8/wAA////////////////AAAAAAAA6///////////////AAAAAAAA4////////////////wAAAAAAbf//////////////////APH5////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>17</X>
          <Y>14</Y>
        </fowSize>
        <bldstate>
          <item key="4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_43">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="11531">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_59">
            <BuildingState val1="4" val2="0" val3="689.398438">
              <time>
                <timestamp>306.561</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_60">
            <BuildingState val1="7" val2="0" val3="686.711243">
              <time>
                <timestamp>306.561981</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_27">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-1-11">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_61">
            <BuildingState val1="8" val2="0" val3="682.543335">
              <time>
                <timestamp>306.567566</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="6242">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="5444">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="skjal">
      <TownState>
        <specialstate>
          <item key="map.collect_wirselkraut">
            <string>77</string>
          </item>
          <item key="map.collect_eitrige">
            <string>33</string>
          </item>
          <item key="map.collect_gulmond">
            <string>50</string>
          </item>
          <item key="map.collect_tarnele">
            <string>131</string>
          </item>
          <item key="map.collect_shurin">
            <string>14</string>
          </item>
          <item key="map.collect_belmart">
            <string>17</string>
          </item>
          <item key="map.collect_donf">
            <string>12</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_alraune">
            <string>6</string>
          </item>
          <item key="map.collect_atmon">
            <string>0</string>
          </item>
          <item key="map.collect_ilmen">
            <string>58</string>
          </item>
          <item key="map.collect_finage">
            <string>0</string>
          </item>
          <item key="map.collect_joruga">
            <string>2</string>
          </item>
          <item key="map.collect_thonnys">
            <string>13</string>
          </item>
          <item key="map.collect_lotus">
            <string>0</string>
          </item>
          <item key="map.collect_olgin">
            <string>0</string>
          </item>
          <item key="map.collect_kairan">
            <string>0</string>
          </item>
          <item key="map.collect_einbeere">
            <string>100</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8T//////////////////////wDu/wAA////////////////////2gAAAAAAAP///////////////////wAAAAAAAP///////////////////wAAAAAAAP///////////////////wAAAAAAAP/////////////////////JvP8AAP//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="123-68">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_64">
            <BuildingState val1="1" val2="0" val3="698.4891">
              <time>
                <timestamp>309.605652</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_44">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_63">
            <BuildingState val1="2" val2="0" val3="698.4902">
              <time>
                <timestamp>309.61322</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="35-28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_62">
            <BuildingState val1="2" val2="0" val3="698.489258">
              <time>
                <timestamp>310.390076</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-1-113">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="99-42">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="116-81">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>699.2098</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="110-83">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>699.2099</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="114-76">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>699.21</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="121-77">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>699.210144</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="map">
      <TownState>
        <specialstate />
        <fowData />
        <fowSize>
          <X>0</X>
          <Y>0</Y>
        </fowSize>
        <bldstate />
      </TownState>
    </item>
    <item key="prem">
      <TownState>
        <specialstate>
          <item key="map.collect_wirselkraut">
            <string>77</string>
          </item>
          <item key="map.collect_eitrige">
            <string>33</string>
          </item>
          <item key="map.collect_gulmond">
            <string>53</string>
          </item>
          <item key="map.collect_tarnele">
            <string>136</string>
          </item>
          <item key="map.collect_shurin">
            <string>14</string>
          </item>
          <item key="map.collect_belmart">
            <string>17</string>
          </item>
          <item key="map.collect_donf">
            <string>12</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_alraune">
            <string>6</string>
          </item>
          <item key="map.collect_atmon">
            <string>0</string>
          </item>
          <item key="map.collect_ilmen">
            <string>67</string>
          </item>
          <item key="map.collect_finage">
            <string>0</string>
          </item>
          <item key="map.collect_joruga">
            <string>3</string>
          </item>
          <item key="map.collect_thonnys">
            <string>13</string>
          </item>
          <item key="map.collect_lotus">
            <string>2</string>
          </item>
          <item key="map.collect_olgin">
            <string>2</string>
          </item>
          <item key="map.collect_kairan">
            <string>2</string>
          </item>
          <item key="map.collect_einbeere">
            <string>107</string>
          </item>
          <item key="betascathal">
            <string>2</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////AP///////////////////////6etAAAA//////////////8AAAD/AAAAAAAA/////////////wAAAAAAAAAAAAAA/////////////wAAAAAAAAAAAAAA/////////////wAAAAAAAAAAAOP//////////////57///8AAAAA////////////////////////AAAAAP///////////////////////8sAAP////////////////////////8AAP//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_67">
            <BuildingState val1="2" val2="0" val3="730.6212">
              <time>
                <timestamp>317.5383</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_65">
            <BuildingState val1="2" val2="0" val3="725.3616">
              <time>
                <timestamp>317.538666</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="155-12">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>317.5392</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_30">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="144-15">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>317.5394</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_31">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="150-19">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>317.539459</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_45">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="149-10">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>317.53952</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_66">
            <BuildingState val1="1" val2="0" val3="725.3614">
              <time>
                <timestamp>319.4027</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="207-46">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_68">
            <BuildingState val1="2" val2="0" val3="725.3608">
              <time>
                <timestamp>323.447083</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_47">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_69">
            <BuildingState val1="2" val2="0" val3="901.595032">
              <time>
                <timestamp>322.42395</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-3869">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_29">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="19310">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="15734">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="10354">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="051">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-1053">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="41-3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="4119">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="mineprem">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="210-28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="guddasun">
      <TownState>
        <specialstate>
          <item key="map.collect_wirselkraut">
            <string>11</string>
          </item>
          <item key="map.collect_eitrige">
            <string>9</string>
          </item>
          <item key="map.collect_gulmond">
            <string>16</string>
          </item>
          <item key="map.collect_tarnele">
            <string>36</string>
          </item>
          <item key="map.collect_shurin">
            <string>4</string>
          </item>
          <item key="map.collect_belmart">
            <string>2</string>
          </item>
          <item key="map.collect_donf">
            <string>1</string>
          </item>
          <item key="map.collect_menchal">
            <string>0</string>
          </item>
          <item key="map.collect_alraune">
            <string>1</string>
          </item>
          <item key="map.collect_atmon">
            <string>0</string>
          </item>
          <item key="map.collect_ilmen">
            <string>16</string>
          </item>
          <item key="map.collect_finage">
            <string>0</string>
          </item>
          <item key="map.collect_joruga">
            <string>1</string>
          </item>
          <item key="map.collect_thonnys">
            <string>4</string>
          </item>
          <item key="map.collect_lotus">
            <string>0</string>
          </item>
          <item key="map.collect_olgin">
            <string>0</string>
          </item>
          <item key="map.collect_kairan">
            <string>0</string>
          </item>
          <item key="map.collect_einbeere">
            <string>41</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////8A/////////////////wAA////////////////AAAA/////////////wAAAAD/////////////AAAAAP////////////8AAAD///////////////9v3///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>13</X>
          <Y>17</Y>
        </fowSize>
        <bldstate>
          <item key="93-96">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_27">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_40">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="47-94">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="kord">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////AAAAAAAAAP////////////////8AAAAAAAAA////////////////GAAAAAAAAAD///////////////8AAAAAAAAA8/////////////////+1AAAA//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8=</fowData>
        <fowSize>
          <X>19</X>
          <Y>15</Y>
        </fowSize>
        <bldstate>
          <item key="2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_54">
            <BuildingState val1="1" val2="0" val3="340.607849">
              <time>
                <timestamp>340.607849</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_24">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_53">
            <BuildingState val1="3" val2="0" val3="340.612">
              <time>
                <timestamp>340.612</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_55">
            <BuildingState val1="3" val2="0" val3="537.3555">
              <time>
                <timestamp>340.614624</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_42">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_23">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_41">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_52">
            <BuildingState val1="3" val2="0" val3="341.456818">
              <time>
                <timestamp>341.456818</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="105-43">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="79-50">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="aryn">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////AAAA/////////////////wAAAAD/////////////////AAAAAP////////////////8AAAAA////////////////////AP///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>16</X>
          <Y>16</Y>
        </fowSize>
        <bldstate>
          <item key="trader_57">
            <BuildingState val1="4" val2="0" val3="353.418976">
              <time>
                <timestamp>353.418976</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="44-16">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_25">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-3-52">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="runinsha">
      <TownState>
        <specialstate>
          <item key="map.collect_tarnele">
            <string>113</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////wAA//////////8AAAD//////////wAA/////////////wD///////////////////////////////////////////////////////////////////////////////8=</fowData>
        <fowSize>
          <X>10</X>
          <Y>12</Y>
        </fowSize>
        <bldstate>
          <item key="3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="14-61">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="38-46">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_58">
            <BuildingState val1="1" val2="0" val3="549.474548">
              <time>
                <timestamp>354.530518</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="62-108">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_56">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="treban">
      <TownState>
        <specialstate />
        <fowData>/////////////////////////////////////////////////////wAAAP///////////wAAAP//////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>11</X>
          <Y>10</Y>
        </fowSize>
        <bldstate>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="27-74">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_56">
            <BuildingState val1="3" val2="0" val3="356.738434">
              <time>
                <timestamp>356.738434</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="runin">
      <TownState>
        <specialstate />
        <fowData>//////////////////////////////////////////////////////////////////////////8A////////////AP//////////AAD//////////wAA//////////8AAP//////////AAD/////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>9</X>
          <Y>17</Y>
        </fowSize>
        <bldstate>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="63-26">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_89">
            <BuildingState val1="2" val2="0" val3="543.565063">
              <time>
                <timestamp>361.397461</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="97-113">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="114-124">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="ljasdahl">
      <TownState>
        <specialstate>
          <item key="lobpreisungenID">
            <string>0</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////xgAAWWIvSf//////////////////AAAAAAAAAAAA////////////////AAAAAAAAAAAA/////////////////wAAAAAAAAAA/////////////////wAAAAAAAAAA/////////////////wAAAAAAAADR//////////////////8AAAAAAN//////////////////////NwAy7P//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_49">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="107-117">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3-74">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_71">
            <BuildingState val1="5" val2="0" val3="1058.5094">
              <time>
                <timestamp>370.3964</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_70">
            <BuildingState val1="4" val2="0" val3="1058.50977">
              <time>
                <timestamp>370.3982</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_72">
            <BuildingState val1="2" val2="0" val3="1058.50952">
              <time>
                <timestamp>370.400024</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_32">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_33">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="58-96">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="61-61">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>370.42157</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="69-69">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>370.4217</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="57-70">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>370.4218</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="30-54">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="hjalland">
      <TownState>
        <specialstate />
        <fowData>//////////////////////////////////////////////////////////////////////////////8AAAD//////////wAAAP//////////AAAA////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>10</X>
          <Y>11</Y>
        </fowSize>
        <bldstate>
          <item key="55-54">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="65-48">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="65-39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="54-28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="serske">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////7sT/////////////////////AAAAAAD/////////////////AAAAANgAAAD/////////////////6AAAAAAAAP//////////////////tQAAAAAA////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>19</X>
          <Y>14</Y>
        </fowSize>
        <bldstate>
          <item key="57-112">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="66-106">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>385.692047</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="72-106">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>385.692047</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="77-102">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>385.692047</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="103-53">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="82-31">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="merske">
      <TownState>
        <specialstate />
        <fowData>/////////////////////////////////////////////////////////////////////////////+/wAAD0//////////////8AAAAAAOH/////////////8gAAAAAA////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>16</X>
          <Y>11</Y>
        </fowSize>
        <bldstate>
          <item key="86-65">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_13">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_14">
            <BuildingState val1="2" val2="0" val3="388.477844">
              <time>
                <timestamp>388.477844</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_10">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="99-124">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="96-92">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="harbor_booked_serske-merske-sea">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="efferdun">
      <TownState>
        <specialstate>
          <item key="map.immanman_time">
            <string>391</string>
          </item>
          <item key="map.beilunk_hint_triggered">
            <string>true</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////AAAA////////////////AAAAAP//////////////AAAAAP////////////8AAAAAAP////////////8AAAAAAP//////////////AAAAAP//////////////AADs////////////////7wD/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>14</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="31-19">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_11">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_6">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_17">
            <BuildingState val1="1" val2="0" val3="389.781">
              <time>
                <timestamp>389.781</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_21">
            <BuildingState val1="3" val2="0" val3="389.78183">
              <time>
                <timestamp>389.78183</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_15">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="20-68">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>389.785553</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="15-69">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>389.785553</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="45-39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="10-69">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>389.7856</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_18">
            <BuildingState val1="3" val2="0" val3="391.399323">
              <time>
                <timestamp>391.399323</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="22-77">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>389.786774</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_19">
            <BuildingState val1="3" val2="0" val3="390.521667">
              <time>
                <timestamp>390.521667</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_16">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_14">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="rovamund">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////cP////////////////////8Aaf///////////////////wAA//////////////////+oeQCb/////////////////wAAAAAA/////////////////wAAAAD/////////////////AAAAANL///////////////8AAAAA/////////////////wAAAAD//////////////////wAAof////////////////////L/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>16</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="86-6">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_10">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_12">
            <BuildingState val1="4" val2="0" val3="423.657074">
              <time>
                <timestamp>404.409454</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_13">
            <BuildingState val1="2" val2="0" val3="404.414917">
              <time>
                <timestamp>404.414917</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="4-94">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="75-62">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>407.3782</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_9">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="hostel_6">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_11">
            <BuildingState val1="3" val2="0" val3="423.659363">
              <time>
                <timestamp>405.406342</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="29-152">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="68-64">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>407.3785</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="62-67">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>407.3789</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="90-81">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="nordvest">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////igAAAAAAAAAAAAAAvf//////////YQAAAAAAAAAAAAAAY///////////WAAAAAAAAAAAAAAAuv//////////ewAAAAAAAAAAAAAAuv//////////VwAAAAAAAAAAAAAAiv//////////ZAAAAAAAAAAAAAAAjv//////////SwAAAAAAAAAAAAAAdP//////////NgAAAAAAAAAAAAAAc///////////LgAAAAAAAAAAAAAAd///////////KwAAAAAAAAAAAAAAUv//////////OAAAAAAAAAAAAAAAIf//////////RQAAAAAAAAAAAABQ////////////QQAAAAAAAAAAAHv/////////////PQAAAAAAAAAAAAD//////////////38AAAAAAAAAAMX/////////////////8P/c3d3d3P//////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="41-165">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_11">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3013">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_8">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_5">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="72108">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="184-39">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="castle">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="kravik">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////r/////////////8AAAD///////////8AAAD///////////8AAAD///////////8AAAD/////////////AAD/////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>11</X>
          <Y>15</Y>
        </fowSize>
        <bldstate>
          <item key="81-37">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="59-120">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="skelelle">
      <TownState>
        <specialstate />
        <fowData>//////////////////////////////////////////////8AAP///////wAA////////AAD/////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>7</X>
          <Y>11</Y>
        </fowSize>
        <bldstate>
          <item key="71-31">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="70-104">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_12">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_9">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="peilinen">
      <TownState>
        <specialstate />
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////wAAAAAA+////////////////////wAAAAAAAP///////////////////wAAAAAAAP//////////////////AAAAAAAAAP////////////////////8AAAAAAP//////////////////////+AAA////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="-10-128">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="72-63">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_9">
            <BuildingState val1="6" val2="0" val3="747.5108">
              <time>
                <timestamp>428.4384</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="hostel_7">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_10">
            <BuildingState val1="4" val2="0" val3="747.5119">
              <time>
                <timestamp>428.4399</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="25-52">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="48-69">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>748.222046</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="59-74">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>748.222168</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="57-60">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>748.222168</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="62-61">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>748.222168</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="breida">
      <TownState>
        <specialstate />
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8AAAAAAP///////////////wAAAAAAAAD///////////////8AAAAAAAAA////////////////3gAAAAAA///////////////////TAAAA/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>18</X>
          <Y>15</Y>
        </fowSize>
        <bldstate>
          <item key="-20-38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_8">
            <BuildingState val1="3" val2="0" val3="432.5944">
              <time>
                <timestamp>432.5944</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_5">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="hostel_9">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-43-78">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="69-105">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_6">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-2-66">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="10">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="ftjoila">
      <TownState>
        <specialstate />
        <fowData>//////////////////////////////////////////////////////////8AAP///////////////wAA////////////////AP///////////////////////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>12</X>
          <Y>9</Y>
        </fowSize>
        <bldstate>
          <item key="48-93">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="95-70">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="87-40">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="tjoila">
      <TownState>
        <specialstate />
        <fowData>/////////////////////////////////////////////////////////////////////wAAAP//////////////AAAAAP///////////////wAAAP//////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>14</X>
          <Y>9</Y>
        </fowSize>
        <bldstate>
          <item key="46-72">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="115-53">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="68-80">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="rukian">
      <TownState>
        <specialstate>
          <item key="rukcanni_delay">
            <string>924</string>
          </item>
          <item key="rukcanni">
            <string>2</string>
          </item>
        </specialstate>
        <fowData>////////////////////////////////////////////////////////////AAAA/////////////////////////////////////////////////////////w==</fowData>
        <fowSize>
          <X>12</X>
          <Y>6</Y>
        </fowSize>
        <bldstate>
          <item key="60-43">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_17">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="60-59">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_12">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="106-38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="112-61">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="84-63">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="79-38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="fangbodi">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////AAD///////////////////////////////////////8=</fowData>
        <fowSize>
          <X>6</X>
          <Y>7</Y>
        </fowSize>
        <bldstate>
          <item key="73-70">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="99-75">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_57">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="62-101">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="90-75">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="71-75">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="angbodirtal">
      <TownState>
        <specialstate />
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////8AAAD///////////8AAAD///////////8AAAD///////////8AAAD///////////8AAP////////////8AAP//////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>11</X>
          <Y>17</Y>
        </fowSize>
        <bldstate>
          <item key="32-61">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_7">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_18">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_19">
            <BuildingState val1="2" val2="0" val3="912.6234">
              <time>
                <timestamp>458.4097</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="8">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="bodon">
      <TownState>
        <specialstate>
          <item key="baerhag_gotfood">
            <string>1</string>
          </item>
          <item key="map.baerhag_journey">
            <string>0</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>92</string>
          </item>
        </specialstate>
        <fowData>///////////////////////////////////////////////////////////VZ8j///////////////////8AAAAAiv////////////////8AAAAAAP////////////////8AAAAAAP////////////////8AngAA//////////////9pAP//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>17</X>
          <Y>15</Y>
        </fowSize>
        <bldstate>
          <item key="62-138">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="121-129">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="orkanger">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////////////AAD///////////8AAAD///////////8AAAD/////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>11</X>
          <Y>13</Y>
        </fowSize>
        <bldstate>
          <item key="41-48">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_34">
            <BuildingState val1="6" val2="0" val3="868.7281">
              <time>
                <timestamp>491.799225</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="95-94">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="80-46">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_28">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_15">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_19">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="clanegh">
      <TownState>
        <specialstate>
          <item key="hasgar-weg">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////8AAAD//////////////////////98AAAD////////////////yAAAAAAAAACT///////////////9tAAAAAAAAWP////////////////8AAAAAAAAA//////////////////8/AAAAAAD/////////////////////zQAAAF3//////////////////////28Aev//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>19</Y>
        </fowSize>
        <bldstate>
          <item key="72-8">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_29">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_31">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_36">
            <BuildingState val1="1" val2="0" val3="872.4591">
              <time>
                <timestamp>497.391876</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_20">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_16">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="162-119">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_30">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_37">
            <BuildingState val1="5" val2="0" val3="498.3582">
              <time>
                <timestamp>498.3582</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="35-84">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_35">
            <BuildingState val1="2" val2="0" val3="872.4594">
              <time>
                <timestamp>499.4125</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="153-99">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="92-89">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>874.2419</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="87-89">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>874.2419</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="78-82">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>874.2419</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="80-88">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>874.2419</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="87-82">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>874.2419</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="85-78">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>874.2419</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="tyldon">
      <TownState>
        <specialstate>
          <item key="map.collect_tarnele">
            <string>96</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////58AAAD/////////////////AAAAAAD//////////////6wAAAAAAP//////////////6wAAAAAA//////////////8AAAAAAADt/////////////wAAAAAAAP//////////////4gAAAAAA////////////////gQAAAP///////////////////zXI////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>16</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="-7-42">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="41-142">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="blacksmith_37">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_52">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="55-59">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>501.728577</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="53-69">
            <BuildingState val1="3" val2="0" val3="0">
              <time>
                <timestamp>501.728577</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="59-66">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>501.728577</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_79">
            <BuildingState val1="2" val2="0" val3="502.4585">
              <time>
                <timestamp>502.4585</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="50-62">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>501.728577</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_80">
            <BuildingState val1="3" val2="0" val3="877.3987">
              <time>
                <timestamp>502.4583</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="daspota">
      <TownState>
        <specialstate>
          <item key="map.collect_wirselkraut">
            <string>57</string>
          </item>
          <item key="fd_daspota3_3">
            <string>1</string>
          </item>
          <item key="map.collect_eitrige">
            <string>33</string>
          </item>
          <item key="map.collect_gulmond">
            <string>41</string>
          </item>
          <item key="map.collect_tarnele">
            <string>115</string>
          </item>
          <item key="map.collect_shurin">
            <string>17</string>
          </item>
          <item key="map.collect_belmart">
            <string>18</string>
          </item>
          <item key="map.collect_donf">
            <string>13</string>
          </item>
          <item key="map.collect_menchal">
            <string>0</string>
          </item>
          <item key="map.collect_alraune">
            <string>10</string>
          </item>
          <item key="map.collect_atmon">
            <string>0</string>
          </item>
          <item key="map.collect_ilmen">
            <string>53</string>
          </item>
          <item key="map.collect_finage">
            <string>0</string>
          </item>
          <item key="map.collect_joruga">
            <string>3</string>
          </item>
          <item key="map.collect_thonnys">
            <string>13</string>
          </item>
          <item key="map.collect_lotus">
            <string>0</string>
          </item>
          <item key="map.collect_olgin">
            <string>0</string>
          </item>
          <item key="map.collect_kairan">
            <string>0</string>
          </item>
          <item key="map.collect_einbeere">
            <string>60</string>
          </item>
          <item key="fd_daspota2_4">
            <string>1</string>
          </item>
          <item key="fd_daspota2_3">
            <string>1</string>
          </item>
          <item key="fd_daspota2_7">
            <string>1</string>
          </item>
          <item key="fd_daspota2_2">
            <string>1</string>
          </item>
          <item key="fd_daspota3_1">
            <string>1</string>
          </item>
          <item key="fd_daspota1_7">
            <string>1</string>
          </item>
          <item key="fd_daspota2_1">
            <string>1</string>
          </item>
          <item key="fd_daspota2_5">
            <string>1</string>
          </item>
          <item key="fd_daspota2_6">
            <string>1</string>
          </item>
          <item key="fd_daspota3_2">
            <string>1</string>
          </item>
          <item key="fd_daspota1_4">
            <string>1</string>
          </item>
          <item key="fd_daspota1_6">
            <string>1</string>
          </item>
          <item key="fd_Vendarr">
            <string>1</string>
          </item>
          <item key="fd_daspota1_3">
            <string>1</string>
          </item>
          <item key="fd_daspota1_1">
            <string>1</string>
          </item>
          <item key="fd_daspota1_2">
            <string>1</string>
          </item>
          <item key="fd_daspota1_5">
            <string>1</string>
          </item>
          <item key="fd_daspota_3_4">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////oAAAAAAD/////////////////////AAAAAAAA////////////////////AAAAAAAA////////////////////AAAAAAAA////////////////////AAAAAAAA5/////////////////AAAAAAAAAA//////////////////8AAAAAAAD/////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="53-35">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="15-97">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="10-104">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="23-76">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="96-64">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="50-41">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="51-26">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="23-109">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="29-115">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="72-139">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="86-121">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="79-111">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="42-110">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="29-41">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="93-102">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="2-56">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="34-136">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="52-137">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="78-49">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="17-82">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="87-92">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="60-148">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="78-98">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="80-131">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="76-80">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="rybon">
      <TownState>
        <specialstate />
        <fowData>////////////////////////////////////////////////////////////////////////////////AAD//////////wAAAP///////////wD///////////////////////////////////////////////////////////////////////////////8=</fowData>
        <fowSize>
          <X>10</X>
          <Y>12</Y>
        </fowSize>
        <bldstate>
          <item key="51-21">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_48">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="31-50">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="43-82">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="phexcaer">
      <TownState>
        <specialstate>
          <item key="lobpreisungenID">
            <string>5</string>
          </item>
          <item key="lobpreisungen">
            <string>12</string>
          </item>
          <item key="map.collect_tarnele">
            <string>145</string>
          </item>
          <item key="map.collect_wirselkraut">
            <string>76</string>
          </item>
          <item key="map.collect_alraune">
            <string>3</string>
          </item>
          <item key="map.schmied_already_asked">
            <string>1</string>
          </item>
          <item key="phex_temple_isin">
            <string>1</string>
          </item>
          <item key="phex_temple_lastcheck">
            <string>944.5094604492188</string>
          </item>
          <item key="map.phex_archiv_antrag">
            <string>0</string>
          </item>
          <item key="praxis_asked_hyggelik">
            <string>1</string>
          </item>
          <item key="firstbrothel">
            <string>1</string>
          </item>
          <item key="map.quacksalberinfo">
            <string>1</string>
          </item>
          <item key="map.collect_eitrige">
            <string>38</string>
          </item>
          <item key="map.collect_gulmond">
            <string>57</string>
          </item>
          <item key="map.collect_shurin">
            <string>15</string>
          </item>
          <item key="map.collect_belmart">
            <string>24</string>
          </item>
          <item key="map.collect_donf">
            <string>11</string>
          </item>
          <item key="map.collect_menchal">
            <string>2</string>
          </item>
          <item key="map.collect_atmon">
            <string>2</string>
          </item>
          <item key="map.collect_ilmen">
            <string>72</string>
          </item>
          <item key="map.collect_finage">
            <string>2</string>
          </item>
          <item key="map.collect_joruga">
            <string>4</string>
          </item>
          <item key="map.collect_thonnys">
            <string>14</string>
          </item>
          <item key="map.collect_lotus">
            <string>2</string>
          </item>
          <item key="map.collect_olgin">
            <string>2</string>
          </item>
          <item key="map.collect_kairan">
            <string>2</string>
          </item>
          <item key="map.collect_einbeere">
            <string>122</string>
          </item>
        </specialstate>
        <fowData>///////////////////////////////////////////////////////////////////////////////////////////////6AAAAAAAAALn////////////////6AAAAAAAAALj///////////////9SAAAAAAAAALv///////////////9qAAAAAAAAALv/////////AAAAAAD///9sAADX3///////////AAAAAAAAAAAAAABc////////////AAAAAAAAAAAAAAAAnf//////////AAAAAAAAAAAAAAAAAP//////////AAAAAAAAAAAAAAAAAP//////////AAAAAAAAAAAAAAAAAOD//////////wAAAAAAAAAAAAAAAFz///////////9CbAAAAAAAAAAAv///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>20</X>
          <Y>20</Y>
        </fowSize>
        <bldstate>
          <item key="3422">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_22">
            <BuildingState val1="7" val2="0" val3="784.681763">
              <time>
                <timestamp>784.681763</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="128-72">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3-25">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>786.3353</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="56-160">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_30">
            <BuildingState val1="2" val2="0" val3="786.3356">
              <time>
                <timestamp>785.394958</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_31">
            <BuildingState val1="2" val2="0" val3="841.5635">
              <time>
                <timestamp>785.395142</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="119-163">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="130-145">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="136-134">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="142-143">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="144-150">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="9-31">
            <BuildingState val1="5" val2="0" val3="0">
              <time>
                <timestamp>786.3353</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="3-34">
            <BuildingState val1="4" val2="0" val3="0">
              <time>
                <timestamp>786.3354</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="4-17">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>786.335449</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_43">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="71-66">
            <BuildingState val1="1" val2="0" val3="0">
              <time>
                <timestamp>787.3505</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="61-62">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>787.3505</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="55-65">
            <BuildingState val1="2" val2="0" val3="0">
              <time>
                <timestamp>787.3505</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="67-62">
            <BuildingState val1="6" val2="0" val3="0">
              <time>
                <timestamp>787.3505</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="trader_29">
            <BuildingState val1="3" val2="0" val3="1000.59937">
              <time>
                <timestamp>787.3506</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="45-52">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="healer_12">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-73-59">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-4613">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-56-34">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-81-21">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-615">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="55-56">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-65-27">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="14-75">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_13">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="42-20">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="5314">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="919">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="25">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="563">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="423">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="6816">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="2215">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="200">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="94">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="820">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="27">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="9216">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="-9-2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="24">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="119-47">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="23">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="144-1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="groenvel">
      <TownState>
        <specialstate />
        <fowData>/////////////////////////////////////////////////////////////////////////////////////////////////////////////9m8/////////////////wAA/////////////////wAAAP////////////8AAAAAAP////////////8AAAAAAP//////////////qwAAAP////////////////8AAP//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////</fowData>
        <fowSize>
          <X>14</X>
          <Y>18</Y>
        </fowSize>
        <bldstate>
          <item key="0-72">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="72-86">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="76-46">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="112-70">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="temple_25">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="89-32">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="group1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="group2">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="group3">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="group4">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
    <item key="einsiedl">
      <TownState>
        <specialstate>
          <item key="methermit">
            <string>1</string>
          </item>
        </specialstate>
        <fowData>/////////////////////////////////////wAA////////////AAD/////////////////////////////////</fowData>
        <fowSize>
          <X>10</X>
          <Y>5</Y>
        </fowSize>
        <bldstate>
          <item key="128-38">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
          <item key="1">
            <BuildingState val1="-1" val2="0" val3="0">
              <time>
                <timestamp>0</timestamp>
              </time>
              <BanTimeEnd>0</BanTimeEnd>
            </BuildingState>
          </item>
        </bldstate>
      </TownState>
    </item>
  </townstate>
  <mapstate>
    <specialstate>
      <item key="maraskan">
        <string>3</string>
      </item>
      <item key="collect_wirselkraut">
        <string>94</string>
      </item>
      <item key="collect_gulmond">
        <string>76</string>
      </item>
      <item key="collect_eitrige">
        <string>61</string>
      </item>
      <item key="collect_tarnele">
        <string>206</string>
      </item>
      <item key="collect_shurin">
        <string>30</string>
      </item>
      <item key="collect_belmart">
        <string>34</string>
      </item>
      <item key="collect_donf">
        <string>27</string>
      </item>
      <item key="collect_menchal">
        <string>2</string>
      </item>
      <item key="collect_alraune">
        <string>11</string>
      </item>
      <item key="collect_atmon">
        <string>2</string>
      </item>
      <item key="collect_ilmen">
        <string>94</string>
      </item>
      <item key="collect_finage">
        <string>2</string>
      </item>
      <item key="collect_joruga">
        <string>2</string>
      </item>
      <item key="collect_thonnys">
        <string>25</string>
      </item>
      <item key="collect_lotus">
        <string>2</string>
      </item>
      <item key="collect_olgin">
        <string>2</string>
      </item>
      <item key="collect_kairan">
        <string>3</string>
      </item>
      <item key="collect_einbeere">
        <string>157</string>
      </item>
      <item key="dngthorwal_hole">
        <string>1</string>
      </item>
      <item key="hq2triggered">
        <string>1</string>
      </item>
      <item key="lagerpalaver">
        <string>~35~~42~~41~~40~~39~~38~~23~~17~~25~~29~~19~~11~</string>
      </item>
      <item key="map.collect_wirselkraut">
        <string>94</string>
      </item>
      <item key="map.collect_eitrige">
        <string>61</string>
      </item>
      <item key="map.collect_gulmond">
        <string>76</string>
      </item>
      <item key="map.collect_tarnele">
        <string>206</string>
      </item>
      <item key="map.collect_shurin">
        <string>30</string>
      </item>
      <item key="map.collect_belmart">
        <string>34</string>
      </item>
      <item key="map.collect_donf">
        <string>27</string>
      </item>
      <item key="map.collect_menchal">
        <string>2</string>
      </item>
      <item key="map.collect_alraune">
        <string>11</string>
      </item>
      <item key="map.collect_atmon">
        <string>2</string>
      </item>
      <item key="map.collect_ilmen">
        <string>94</string>
      </item>
      <item key="map.collect_finage">
        <string>2</string>
      </item>
      <item key="map.collect_joruga">
        <string>2</string>
      </item>
      <item key="map.collect_thonnys">
        <string>25</string>
      </item>
      <item key="map.collect_lotus">
        <string>2</string>
      </item>
      <item key="map.collect_olgin">
        <string>2</string>
      </item>
      <item key="map.collect_kairan">
        <string>3</string>
      </item>
      <item key="map.collect_einbeere">
        <string>157</string>
      </item>
      <item key="janda_olgardsson">
        <string>1</string>
      </item>
      <item key="borbarads_zeugen">
        <string>1</string>
      </item>
      <item key="hq12_praios">
        <string>141</string>
      </item>
      <item key="reise24_reissender_bach">
        <string>1</string>
      </item>
      <item key="chbodir">
        <string>1</string>
      </item>
      <item key="strasse_101">
        <string>1</string>
      </item>
      <item key="randomstreettextsdone">
        <string>123,137</string>
      </item>
      <item key="hansquest5">
        <string>1</string>
      </item>
      <item key="map.hansquest5">
        <string>1</string>
      </item>
      <item key="hq13_triggered">
        <string>1</string>
      </item>
      <item key="swafnild">
        <string>0</string>
      </item>
      <item key="PirateCaveFound">
        <string>true</string>
      </item>
      <item key="gundridssonfirsthint">
        <string>7</string>
      </item>
      <item key="gundridssonsecondhint">
        <string>9</string>
      </item>
      <item key="gundridssonthirdhint">
        <string>5</string>
      </item>
      <item key="gundridsson_hyg">
        <string>1</string>
      </item>
      <item key="gundridsson_het">
        <string>1</string>
      </item>
      <item key="gundridsson_tra">
        <string>1</string>
      </item>
      <item key="reise58">
        <string>1</string>
      </item>
      <item key="reise57">
        <string>1</string>
      </item>
      <item key="anderealte">
        <string>1</string>
      </item>
      <item key="reise53">
        <string>1</string>
      </item>
      <item key="reise_dungeon_WolfCave_known">
        <string>true</string>
      </item>
      <item key="localname">
        <string>Jandra</string>
      </item>
      <item key="reise56">
        <string>1</string>
      </item>
      <item key="reise55">
        <string>1</string>
      </item>
      <item key="totenschiff_lastmeet">
        <string>363.2293395996094</string>
      </item>
      <item key="strasse_100">
        <string>1</string>
      </item>
      <item key="immanman_time">
        <string>391</string>
      </item>
      <item key="reise3_tjoila-breida">
        <string>1</string>
      </item>
      <item key="reise34">
        <string>1</string>
      </item>
      <item key="reise_dungeon_GoblinCave_known">
        <string>true</string>
      </item>
      <item key="reise54">
        <string>1</string>
      </item>
      <item key="Reise31">
        <string>1</string>
      </item>
      <item key="reise31">
        <string>1</string>
      </item>
      <item key="reise_dungeon_MageRuin_known">
        <string>true</string>
      </item>
      <item key="strasse_99">
        <string>1</string>
      </item>
      <item key="reise_dungeon_DragonCave_known">
        <string>true</string>
      </item>
      <item key="reisender_kraemer">
        <string>1</string>
      </item>
      <item key="reise_dungeon_TempelDesNamenlosen_known">
        <string>true</string>
      </item>
      <item key="Reise52_Ziegenhirte_Gorahhint">
        <string>1</string>
      </item>
      <item key="reise1_varnheim-daspota">
        <string>1</string>
      </item>
      <item key="beilunk_hint_triggered">
        <string>true</string>
      </item>
      <item key="reise_dungeon_AbandonedHostel">
        <string>true</string>
      </item>
      <item key="reise27_bauer">
        <string>1</string>
      </item>
      <item key="reise_dungeon_SpiderCave_known">
        <string>true</string>
      </item>
      <item key="gorah_search">
        <string>2</string>
      </item>
      <item key="reise_dungeon_OrcCave_known">
        <string>true</string>
      </item>
      <item key="moor_steineichenwald">
        <string>1</string>
      </item>
      <item key="schmied_already_asked">
        <string>1</string>
      </item>
      <item key="phex_archiv_antrag">
        <string>0</string>
      </item>
      <item key="quacksalberinfo">
        <string>1</string>
      </item>
      <item key="Greifenraetsel">
        <string>1</string>
      </item>
      <item key="Monolith_Schwarzes_Auge">
        <string>1</string>
      </item>
      <item key="reise22_abenteurer">
        <string>1</string>
      </item>
      <item key="localID">
        <string>0</string>
      </item>
      <item key="reise_HyggeligRoad_PheVil_wayOverWaterKnown">
        <string>true</string>
      </item>
      <item key="reise_HyggeligRoad_PheVil_RoadKnown">
        <string>true</string>
      </item>
      <item key="localName">
        <string>2</string>
      </item>
      <item key="reise_HyggeligDungeon_Known">
        <string>true</string>
      </item>
      <item key="reise19_orkland">
        <string>1</string>
      </item>
      <item key="saying1">
        <string>true</string>
      </item>
      <item key="saying2">
        <string>true</string>
      </item>
      <item key="saying3">
        <string>true</string>
      </item>
      <item key="saying4">
        <string>true</string>
      </item>
      <item key="saying5">
        <string>true</string>
      </item>
      <item key="strasse_102">
        <string>1</string>
      </item>
      <item key="baerhag_journey">
        <string>4</string>
      </item>
      <item key="map.baerhag_journey">
        <string>4</string>
      </item>
      <item key="baerhag_ghost">
        <string>1</string>
      </item>
      <item key="baernecro">
        <string>dead</string>
      </item>
      <item key="reise_HyggeligRoad_PheSkel_RoadKnown">
        <string>true</string>
      </item>
      <item key="reise_HyggeligRoad_FromPhexSkel_EventA_Known">
        <string>true</string>
      </item>
      <item key="grimringbearer">
        <string>1</string>
      </item>
      <item key="map.grimringbearer">
        <string>1</string>
      </item>
    </specialstate>
    <fowData />
    <fowSize>
      <X>0</X>
      <Y>0</Y>
    </fowSize>
  </mapstate>
  <queststate>
    <item key="welcome">
      <QuestState step="1" adata="" />
    </item>
    <item key="ugdalf1">
      <QuestState step="5" adata="" />
    </item>
    <item key="schick_call">
      <QuestState step="2" adata="" />
    </item>
    <item key="ugra_barmaid">
      <QuestState step="1" adata="" />
    </item>
    <item key="qtotenschiff">
      <QuestState step="4" adata="" />
    </item>
    <item key="zandor">
      <QuestState step="1" adata="" />
    </item>
    <item key="throwing_contest">
      <QuestState step="1" adata="" />
    </item>
    <item key="schick_olgardsson">
      <QuestState step="3" adata="" />
    </item>
    <item key="schick_daspota">
      <QuestState step="4" adata="" />
    </item>
    <item key="rukelder">
      <QuestState step="4" adata="" />
    </item>
    <item key="goldbaerhag">
      <QuestState step="6" adata="" />
    </item>
    <item key="quest_erika">
      <QuestState step="3" adata="" />
    </item>
    <item key="schick_ahrensson">
      <QuestState step="4" adata="" />
    </item>
    <item key="schick_egilsdotter">
      <QuestState step="3" adata="" />
    </item>
    <item key="mappieces">
      <QuestState step="9" adata="" />
    </item>
    <item key="schick_firunjasdotter">
      <QuestState step="3" adata="" />
    </item>
    <item key="schick_hjallasson">
      <QuestState step="3" adata="" />
    </item>
    <item key="schick_swafnildsson">
      <QuestState step="4" adata="" />
    </item>
    <item key="simplehouse">
      <QuestState step="0" adata="" />
    </item>
    <item key="schick_torfinsson">
      <QuestState step="4" adata="" />
    </item>
    <item key="schick_siebenstein">
      <QuestState step="5" adata="" />
    </item>
    <item key="goldliebe">
      <QuestState step="4" adata="" />
    </item>
    <item key="met_gundridsson">
      <QuestState step="1" adata="" />
    </item>
    <item key="schick_windenbek">
      <QuestState step="4" adata="" />
    </item>
    <item key="schick_trondesdotter">
      <QuestState step="3" adata="" />
    </item>
    <item key="schick_thurboldsson">
      <QuestState step="3" adata="" />
    </item>
    <item key="schick_joerg">
      <QuestState step="4" adata="" />
    </item>
    <item key="schick_derondan">
      <QuestState step="3" adata="" />
    </item>
    <item key="schick_thinmarsdotter_clanegh">
      <QuestState step="2" adata="" />
    </item>
    <item key="schick_thinmarsdotter">
      <QuestState step="3" adata="" />
    </item>
    <item key="sorduloccupiedbarn_tip">
      <QuestState step="1" adata="" />
    </item>
    <item key="sorduloccupiedbarn">
      <QuestState step="2" adata="" />
    </item>
    <item key="schick_tempelnamenlos">
      <QuestState step="3" adata="" />
    </item>
    <item key="ugdalf2">
      <QuestState step="3" adata="" />
    </item>
    <item key="sordul_kidnapping_tip">
      <QuestState step="1" adata="" />
    </item>
    <item key="sordulkidnapping">
      <QuestState step="2" adata="" />
    </item>
    <item key="orkcave">
      <QuestState step="4" adata="" />
    </item>
    <item key="schick_hyggelik">
      <QuestState step="3" adata="" />
    </item>
    <item key="beilunk_quest_accept">
      <QuestState step="8" adata="" />
    </item>
    <item key="schick_endbattle">
      <QuestState step="3" adata="" />
    </item>
    <item key="phexcaer_phextemple">
      <QuestState step="0" adata="" />
    </item>
    <item key="phexcaer_gueldener">
      <QuestState step="2" adata="" />
    </item>
    <item key="phexcaer_villafight">
      <QuestState step="2" adata="" />
    </item>
    <item key="torkilschasm">
      <QuestState step="4" adata="" />
    </item>
    <item key="goldliebeblumen">
      <QuestState step="5" adata="" />
    </item>
    <item key="goldliebebarde">
      <QuestState step="4" adata="" />
    </item>
    <item key="goldliebemaybe">
      <QuestState step="0" adata="" />
    </item>
    <item key="rukslaughterfishy">
      <QuestState step="2" adata="" />
    </item>
    <item key="rukinn">
      <QuestState step="2" adata="" />
    </item>
    <item key="goldbaerhagaxe">
      <QuestState step="2" adata="" />
    </item>
  </queststate>
  <tips>
    <item key="tipsgemischt">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>41</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_41</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>37</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_37</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>43</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_43</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>34</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_34</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>51</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_51</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>64</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_64</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>59</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_59</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>66</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_66</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>39</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_39</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>45</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_45</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>44</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_44</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>25</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_25</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>62</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_62</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_24</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>56</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_56</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>29</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_29</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>49</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_49</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>4</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_4</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>30</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_30</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>42</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_42</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>63</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_63</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>40</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_40</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>35</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_35</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>48</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_48</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>2</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_2</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>31</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_31</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>65</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_65</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>52</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_52</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>1</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_1</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>0</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_0</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>33</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_33</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>58</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_58</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>47</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_47</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>46</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_46</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>57</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_57</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>32</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_32</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>53</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_53</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>38</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_38</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>36</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_36</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>54</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_54</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>55</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_55</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>3</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_3</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_26</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>61</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_61</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>50</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_50</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>60</tipid>
            <area>tipsgemischt</area>
            <locastring>tipsgemischt_60</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="tipswaffen">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>2</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_2</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>4</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_4</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>0</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_0</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>3</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_3</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>1</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_1</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>tipswaffen</area>
            <locastring>tipswaffen_19</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="thorwal">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>63</tipid>
            <area>thorwal</area>
            <locastring>thorwal_63</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>65</tipid>
            <area>thorwal</area>
            <locastring>thorwal_65</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>73</tipid>
            <area>thorwal</area>
            <locastring>thorwal_73</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>56</tipid>
            <area>thorwal</area>
            <locastring>thorwal_56</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>82</tipid>
            <area>thorwal</area>
            <locastring>thorwal_82</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>91</tipid>
            <area>thorwal</area>
            <locastring>thorwal_91</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>81</tipid>
            <area>thorwal</area>
            <locastring>thorwal_81</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>93</tipid>
            <area>thorwal</area>
            <locastring>thorwal_93</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>70</tipid>
            <area>thorwal</area>
            <locastring>thorwal_70</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>57</tipid>
            <area>thorwal</area>
            <locastring>thorwal_57</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>69</tipid>
            <area>thorwal</area>
            <locastring>thorwal_69</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>94</tipid>
            <area>thorwal</area>
            <locastring>thorwal_94</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>86</tipid>
            <area>thorwal</area>
            <locastring>thorwal_86</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>97</tipid>
            <area>thorwal</area>
            <locastring>thorwal_97</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>68</tipid>
            <area>thorwal</area>
            <locastring>thorwal_68</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>84</tipid>
            <area>thorwal</area>
            <locastring>thorwal_84</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>89</tipid>
            <area>thorwal</area>
            <locastring>thorwal_89</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>58</tipid>
            <area>thorwal</area>
            <locastring>thorwal_58</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>71</tipid>
            <area>thorwal</area>
            <locastring>thorwal_71</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>76</tipid>
            <area>thorwal</area>
            <locastring>thorwal_76</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>80</tipid>
            <area>thorwal</area>
            <locastring>thorwal_80</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>95</tipid>
            <area>thorwal</area>
            <locastring>thorwal_95</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>78</tipid>
            <area>thorwal</area>
            <locastring>thorwal_78</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>101</tipid>
            <area>thorwal</area>
            <locastring>thorwal_101</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>77</tipid>
            <area>thorwal</area>
            <locastring>thorwal_77</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>85</tipid>
            <area>thorwal</area>
            <locastring>thorwal_85</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>66</tipid>
            <area>thorwal</area>
            <locastring>thorwal_66</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>83</tipid>
            <area>thorwal</area>
            <locastring>thorwal_83</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>87</tipid>
            <area>thorwal</area>
            <locastring>thorwal_87</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>100</tipid>
            <area>thorwal</area>
            <locastring>thorwal_100</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>59</tipid>
            <area>thorwal</area>
            <locastring>thorwal_59</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>96</tipid>
            <area>thorwal</area>
            <locastring>thorwal_96</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>90</tipid>
            <area>thorwal</area>
            <locastring>thorwal_90</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>60</tipid>
            <area>thorwal</area>
            <locastring>thorwal_60</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>98</tipid>
            <area>thorwal</area>
            <locastring>thorwal_98</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>67</tipid>
            <area>thorwal</area>
            <locastring>thorwal_67</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>88</tipid>
            <area>thorwal</area>
            <locastring>thorwal_88</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>99</tipid>
            <area>thorwal</area>
            <locastring>thorwal_99</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>72</tipid>
            <area>thorwal</area>
            <locastring>thorwal_72</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>64</tipid>
            <area>thorwal</area>
            <locastring>thorwal_64</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>62</tipid>
            <area>thorwal</area>
            <locastring>thorwal_62</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>61</tipid>
            <area>thorwal</area>
            <locastring>thorwal_61</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>75</tipid>
            <area>thorwal</area>
            <locastring>thorwal_75</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>92</tipid>
            <area>thorwal</area>
            <locastring>thorwal_92</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>79</tipid>
            <area>thorwal</area>
            <locastring>thorwal_79</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>74</tipid>
            <area>thorwal</area>
            <locastring>thorwal_74</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="tipskraeuter">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>31</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_31</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>37</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_37</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>38</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_38</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>3</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_3</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>2</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_2</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>33</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_33</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>32</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_32</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>35</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_35</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>25</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_25</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>34</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_34</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>4</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_4</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>36</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_36</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_24</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>29</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_29</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>1</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_1</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>0</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_0</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>tipskraeuter</area>
            <locastring>tipskraeuter_26</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="vaermhag">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>vaermhag</area>
            <locastring>vaermhag_12</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="varnheim">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>varnheim</area>
            <locastring>varnheim_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>varnheim</area>
            <locastring>varnheim_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>varnheim</area>
            <locastring>varnheim_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>varnheim</area>
            <locastring>varnheim_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>25</tipid>
            <area>varnheim</area>
            <locastring>varnheim_25</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>varnheim</area>
            <locastring>varnheim_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>varnheim</area>
            <locastring>varnheim_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>varnheim</area>
            <locastring>varnheim_24</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>varnheim</area>
            <locastring>varnheim_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>varnheim</area>
            <locastring>varnheim_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>varnheim</area>
            <locastring>varnheim_26</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>varnheim</area>
            <locastring>varnheim_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>varnheim</area>
            <locastring>varnheim_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>varnheim</area>
            <locastring>varnheim_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>varnheim</area>
            <locastring>varnheim_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>varnheim</area>
            <locastring>varnheim_14</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="auplog">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>auplog</area>
            <locastring>auplog_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>auplog</area>
            <locastring>auplog_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>auplog</area>
            <locastring>auplog_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>auplog</area>
            <locastring>auplog_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>auplog</area>
            <locastring>auplog_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>auplog</area>
            <locastring>auplog_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>auplog</area>
            <locastring>auplog_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>auplog</area>
            <locastring>auplog_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>auplog</area>
            <locastring>auplog_10</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="vilnheim">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>31</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_31</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>30</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_30</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_24</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_26</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>25</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_25</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>29</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_29</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>vilnheim</area>
            <locastring>vilnheim_20</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="oberorken">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>oberorken</area>
            <locastring>oberorken_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>30</tipid>
            <area>oberorken</area>
            <locastring>oberorken_30</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>31</tipid>
            <area>oberorken</area>
            <locastring>oberorken_31</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>34</tipid>
            <area>oberorken</area>
            <locastring>oberorken_34</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>oberorken</area>
            <locastring>oberorken_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>oberorken</area>
            <locastring>oberorken_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>33</tipid>
            <area>oberorken</area>
            <locastring>oberorken_33</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>oberorken</area>
            <locastring>oberorken_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>oberorken</area>
            <locastring>oberorken_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>32</tipid>
            <area>oberorken</area>
            <locastring>oberorken_32</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>29</tipid>
            <area>oberorken</area>
            <locastring>oberorken_29</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>25</tipid>
            <area>oberorken</area>
            <locastring>oberorken_25</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>oberorken</area>
            <locastring>oberorken_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>oberorken</area>
            <locastring>oberorken_26</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>oberorken</area>
            <locastring>oberorken_24</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="felsteyn">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>felsteyn</area>
            <locastring>felsteyn_15</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="brendhil">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>brendhil</area>
            <locastring>brendhil_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>brendhil</area>
            <locastring>brendhil_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>brendhil</area>
            <locastring>brendhil_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>brendhil</area>
            <locastring>brendhil_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>brendhil</area>
            <locastring>brendhil_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>brendhil</area>
            <locastring>brendhil_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>brendhil</area>
            <locastring>brendhil_10</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="manrin">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>manrin</area>
            <locastring>manrin_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>manrin</area>
            <locastring>manrin_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>manrin</area>
            <locastring>manrin_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>manrin</area>
            <locastring>manrin_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>manrin</area>
            <locastring>manrin_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>manrin</area>
            <locastring>manrin_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>manrin</area>
            <locastring>manrin_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>manrin</area>
            <locastring>manrin_21</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="hjalsing">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>hjalsing</area>
            <locastring>hjalsing_20</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="rovik">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>rovik</area>
            <locastring>rovik_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>rovik</area>
            <locastring>rovik_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>rovik</area>
            <locastring>rovik_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>rovik</area>
            <locastring>rovik_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>rovik</area>
            <locastring>rovik_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>rovik</area>
            <locastring>rovik_10</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="overthorn">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>overthorn</area>
            <locastring>overthorn_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>overthorn</area>
            <locastring>overthorn_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>overthorn</area>
            <locastring>overthorn_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>overthorn</area>
            <locastring>overthorn_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>overthorn</area>
            <locastring>overthorn_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>overthorn</area>
            <locastring>overthorn_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>overthorn</area>
            <locastring>overthorn_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>overthorn</area>
            <locastring>overthorn_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>overthorn</area>
            <locastring>overthorn_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>overthorn</area>
            <locastring>overthorn_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>overthorn</area>
            <locastring>overthorn_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>overthorn</area>
            <locastring>overthorn_17</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="tjanset">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>tjanset</area>
            <locastring>tjanset_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>tjanset</area>
            <locastring>tjanset_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>tjanset</area>
            <locastring>tjanset_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>tjanset</area>
            <locastring>tjanset_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>tjanset</area>
            <locastring>tjanset_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>tjanset</area>
            <locastring>tjanset_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>tjanset</area>
            <locastring>tjanset_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>tjanset</area>
            <locastring>tjanset_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>tjanset</area>
            <locastring>tjanset_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>tjanset</area>
            <locastring>tjanset_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>tjanset</area>
            <locastring>tjanset_12</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="liskor">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>liskor</area>
            <locastring>liskor_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>liskor</area>
            <locastring>liskor_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>liskor</area>
            <locastring>liskor_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>liskor</area>
            <locastring>liskor_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>liskor</area>
            <locastring>liskor_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>liskor</area>
            <locastring>liskor_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>liskor</area>
            <locastring>liskor_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>liskor</area>
            <locastring>liskor_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>liskor</area>
            <locastring>liskor_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>liskor</area>
            <locastring>liskor_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>liskor</area>
            <locastring>liskor_15</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="vidsand">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>vidsand</area>
            <locastring>vidsand_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>vidsand</area>
            <locastring>vidsand_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>vidsand</area>
            <locastring>vidsand_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>vidsand</area>
            <locastring>vidsand_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>vidsand</area>
            <locastring>vidsand_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>vidsand</area>
            <locastring>vidsand_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>vidsand</area>
            <locastring>vidsand_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>vidsand</area>
            <locastring>vidsand_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>vidsand</area>
            <locastring>vidsand_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>vidsand</area>
            <locastring>vidsand_21</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="thoss">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>thoss</area>
            <locastring>thoss_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>thoss</area>
            <locastring>thoss_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>thoss</area>
            <locastring>thoss_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>thoss</area>
            <locastring>thoss_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>thoss</area>
            <locastring>thoss_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>thoss</area>
            <locastring>thoss_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>thoss</area>
            <locastring>thoss_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>thoss</area>
            <locastring>thoss_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>thoss</area>
            <locastring>thoss_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>thoss</area>
            <locastring>thoss_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>thoss</area>
            <locastring>thoss_10</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="ala">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>ala</area>
            <locastring>ala_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>ala</area>
            <locastring>ala_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>ala</area>
            <locastring>ala_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>ala</area>
            <locastring>ala_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>ala</area>
            <locastring>ala_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>ala</area>
            <locastring>ala_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>ala</area>
            <locastring>ala_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>ala</area>
            <locastring>ala_10</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="orvil">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>orvil</area>
            <locastring>orvil_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>orvil</area>
            <locastring>orvil_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>orvil</area>
            <locastring>orvil_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>orvil</area>
            <locastring>orvil_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>orvil</area>
            <locastring>orvil_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>orvil</area>
            <locastring>orvil_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>orvil</area>
            <locastring>orvil_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>orvil</area>
            <locastring>orvil_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>orvil</area>
            <locastring>orvil_19</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="ottarje">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>ottarje</area>
            <locastring>ottarje_26</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>ottarje</area>
            <locastring>ottarje_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>ottarje</area>
            <locastring>ottarje_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>ottarje</area>
            <locastring>ottarje_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>ottarje</area>
            <locastring>ottarje_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>ottarje</area>
            <locastring>ottarje_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>ottarje</area>
            <locastring>ottarje_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>ottarje</area>
            <locastring>ottarje_24</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>ottarje</area>
            <locastring>ottarje_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>ottarje</area>
            <locastring>ottarje_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>ottarje</area>
            <locastring>ottarje_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>ottarje</area>
            <locastring>ottarje_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>25</tipid>
            <area>ottarje</area>
            <locastring>ottarje_25</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>ottarje</area>
            <locastring>ottarje_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>ottarje</area>
            <locastring>ottarje_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>ottarje</area>
            <locastring>ottarje_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>ottarje</area>
            <locastring>ottarje_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>ottarje</area>
            <locastring>ottarje_21</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="skjal">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>skjal</area>
            <locastring>skjal_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>skjal</area>
            <locastring>skjal_24</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>skjal</area>
            <locastring>skjal_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>skjal</area>
            <locastring>skjal_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>skjal</area>
            <locastring>skjal_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>skjal</area>
            <locastring>skjal_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>skjal</area>
            <locastring>skjal_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>skjal</area>
            <locastring>skjal_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>skjal</area>
            <locastring>skjal_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>skjal</area>
            <locastring>skjal_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>skjal</area>
            <locastring>skjal_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>skjal</area>
            <locastring>skjal_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>skjal</area>
            <locastring>skjal_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>skjal</area>
            <locastring>skjal_23</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="prem">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>34</tipid>
            <area>prem</area>
            <locastring>prem_34</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>31</tipid>
            <area>prem</area>
            <locastring>prem_31</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>prem</area>
            <locastring>prem_24</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>33</tipid>
            <area>prem</area>
            <locastring>prem_33</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>25</tipid>
            <area>prem</area>
            <locastring>prem_25</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>prem</area>
            <locastring>prem_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>prem</area>
            <locastring>prem_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>prem</area>
            <locastring>prem_26</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>30</tipid>
            <area>prem</area>
            <locastring>prem_30</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>29</tipid>
            <area>prem</area>
            <locastring>prem_29</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>32</tipid>
            <area>prem</area>
            <locastring>prem_32</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="guddasun">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>guddasun</area>
            <locastring>guddasun_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>guddasun</area>
            <locastring>guddasun_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>guddasun</area>
            <locastring>guddasun_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>guddasun</area>
            <locastring>guddasun_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>guddasun</area>
            <locastring>guddasun_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>guddasun</area>
            <locastring>guddasun_8</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="kord">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>kord</area>
            <locastring>kord_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>kord</area>
            <locastring>kord_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>kord</area>
            <locastring>kord_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>kord</area>
            <locastring>kord_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>kord</area>
            <locastring>kord_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>kord</area>
            <locastring>kord_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>kord</area>
            <locastring>kord_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>kord</area>
            <locastring>kord_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>kord</area>
            <locastring>kord_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>24</tipid>
            <area>kord</area>
            <locastring>kord_24</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="aryn">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>aryn</area>
            <locastring>aryn_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>aryn</area>
            <locastring>aryn_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>aryn</area>
            <locastring>aryn_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>aryn</area>
            <locastring>aryn_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>aryn</area>
            <locastring>aryn_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>aryn</area>
            <locastring>aryn_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>aryn</area>
            <locastring>aryn_9</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="runinsha">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>runinsha</area>
            <locastring>runinsha_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>runinsha</area>
            <locastring>runinsha_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>runinsha</area>
            <locastring>runinsha_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>runinsha</area>
            <locastring>runinsha_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>runinsha</area>
            <locastring>runinsha_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>runinsha</area>
            <locastring>runinsha_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>runinsha</area>
            <locastring>runinsha_9</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="treban">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>treban</area>
            <locastring>treban_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>treban</area>
            <locastring>treban_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>treban</area>
            <locastring>treban_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>treban</area>
            <locastring>treban_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>treban</area>
            <locastring>treban_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>treban</area>
            <locastring>treban_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>treban</area>
            <locastring>treban_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>treban</area>
            <locastring>treban_13</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="ljasdahl">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>ljasdahl</area>
            <locastring>ljasdahl_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>ljasdahl</area>
            <locastring>ljasdahl_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>ljasdahl</area>
            <locastring>ljasdahl_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>ljasdahl</area>
            <locastring>ljasdahl_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>ljasdahl</area>
            <locastring>ljasdahl_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>ljasdahl</area>
            <locastring>ljasdahl_16</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="serske">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>serske</area>
            <locastring>serske_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>serske</area>
            <locastring>serske_6</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="merske">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>merske</area>
            <locastring>merske_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>merske</area>
            <locastring>merske_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>merske</area>
            <locastring>merske_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>merske</area>
            <locastring>merske_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>merske</area>
            <locastring>merske_15</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="efferdun">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>efferdun</area>
            <locastring>efferdun_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>efferdun</area>
            <locastring>efferdun_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>efferdun</area>
            <locastring>efferdun_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>efferdun</area>
            <locastring>efferdun_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>efferdun</area>
            <locastring>efferdun_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>efferdun</area>
            <locastring>efferdun_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>efferdun</area>
            <locastring>efferdun_15</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="rovamund">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>rovamund</area>
            <locastring>rovamund_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>rovamund</area>
            <locastring>rovamund_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>rovamund</area>
            <locastring>rovamund_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>rovamund</area>
            <locastring>rovamund_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>rovamund</area>
            <locastring>rovamund_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>rovamund</area>
            <locastring>rovamund_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>rovamund</area>
            <locastring>rovamund_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>rovamund</area>
            <locastring>rovamund_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>rovamund</area>
            <locastring>rovamund_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>rovamund</area>
            <locastring>rovamund_20</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="nordvest">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>nordvest</area>
            <locastring>nordvest_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>nordvest</area>
            <locastring>nordvest_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>nordvest</area>
            <locastring>nordvest_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>nordvest</area>
            <locastring>nordvest_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>nordvest</area>
            <locastring>nordvest_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>nordvest</area>
            <locastring>nordvest_8</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="kravik">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>kravik</area>
            <locastring>kravik_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>kravik</area>
            <locastring>kravik_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>kravik</area>
            <locastring>kravik_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>kravik</area>
            <locastring>kravik_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>kravik</area>
            <locastring>kravik_11</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="skelelle">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>skelelle</area>
            <locastring>skelelle_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>skelelle</area>
            <locastring>skelelle_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>skelelle</area>
            <locastring>skelelle_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>skelelle</area>
            <locastring>skelelle_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>skelelle</area>
            <locastring>skelelle_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>skelelle</area>
            <locastring>skelelle_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>skelelle</area>
            <locastring>skelelle_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>skelelle</area>
            <locastring>skelelle_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>skelelle</area>
            <locastring>skelelle_7</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="peilinen">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>peilinen</area>
            <locastring>peilinen_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>peilinen</area>
            <locastring>peilinen_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>peilinen</area>
            <locastring>peilinen_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>peilinen</area>
            <locastring>peilinen_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>peilinen</area>
            <locastring>peilinen_10</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="breida">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>breida</area>
            <locastring>breida_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>breida</area>
            <locastring>breida_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>breida</area>
            <locastring>breida_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>breida</area>
            <locastring>breida_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>breida</area>
            <locastring>breida_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>breida</area>
            <locastring>breida_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>breida</area>
            <locastring>breida_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>breida</area>
            <locastring>breida_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>breida</area>
            <locastring>breida_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>breida</area>
            <locastring>breida_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>breida</area>
            <locastring>breida_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>breida</area>
            <locastring>breida_12</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="ftjoila">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>4</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_4</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>ftjoila</area>
            <locastring>ftjoila_11</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="tjoila">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>tjoila</area>
            <locastring>tjoila_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>tjoila</area>
            <locastring>tjoila_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>tjoila</area>
            <locastring>tjoila_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>tjoila</area>
            <locastring>tjoila_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>tjoila</area>
            <locastring>tjoila_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>tjoila</area>
            <locastring>tjoila_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>tjoila</area>
            <locastring>tjoila_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>tjoila</area>
            <locastring>tjoila_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>tjoila</area>
            <locastring>tjoila_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>tjoila</area>
            <locastring>tjoila_14</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="rukian">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>rukian</area>
            <locastring>rukian_6</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>rukian</area>
            <locastring>rukian_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>rukian</area>
            <locastring>rukian_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>rukian</area>
            <locastring>rukian_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>rukian</area>
            <locastring>rukian_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>rukian</area>
            <locastring>rukian_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>rukian</area>
            <locastring>rukian_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>rukian</area>
            <locastring>rukian_14</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="angbodirtal">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>angbodirtal</area>
            <locastring>angbodirtal_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>angbodirtal</area>
            <locastring>angbodirtal_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>angbodirtal</area>
            <locastring>angbodirtal_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>angbodirtal</area>
            <locastring>angbodirtal_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>angbodirtal</area>
            <locastring>angbodirtal_9</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>angbodirtal</area>
            <locastring>angbodirtal_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>angbodirtal</area>
            <locastring>angbodirtal_10</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="bodon">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>4</tipid>
            <area>bodon</area>
            <locastring>bodon_4</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>bodon</area>
            <locastring>bodon_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>bodon</area>
            <locastring>bodon_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>bodon</area>
            <locastring>bodon_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>bodon</area>
            <locastring>bodon_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>bodon</area>
            <locastring>bodon_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>bodon</area>
            <locastring>bodon_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>bodon</area>
            <locastring>bodon_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>bodon</area>
            <locastring>bodon_15</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="orkanger">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>orkanger</area>
            <locastring>orkanger_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>orkanger</area>
            <locastring>orkanger_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>orkanger</area>
            <locastring>orkanger_14</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>orkanger</area>
            <locastring>orkanger_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>orkanger</area>
            <locastring>orkanger_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>orkanger</area>
            <locastring>orkanger_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>orkanger</area>
            <locastring>orkanger_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>orkanger</area>
            <locastring>orkanger_9</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="clanegh">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>19</tipid>
            <area>clanegh</area>
            <locastring>clanegh_19</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>15</tipid>
            <area>clanegh</area>
            <locastring>clanegh_15</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>23</tipid>
            <area>clanegh</area>
            <locastring>clanegh_23</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>20</tipid>
            <area>clanegh</area>
            <locastring>clanegh_20</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>13</tipid>
            <area>clanegh</area>
            <locastring>clanegh_13</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>17</tipid>
            <area>clanegh</area>
            <locastring>clanegh_17</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>21</tipid>
            <area>clanegh</area>
            <locastring>clanegh_21</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>22</tipid>
            <area>clanegh</area>
            <locastring>clanegh_22</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>16</tipid>
            <area>clanegh</area>
            <locastring>clanegh_16</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>18</tipid>
            <area>clanegh</area>
            <locastring>clanegh_18</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>14</tipid>
            <area>clanegh</area>
            <locastring>clanegh_14</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="tyldon">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>12</tipid>
            <area>tyldon</area>
            <locastring>tyldon_12</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>10</tipid>
            <area>tyldon</area>
            <locastring>tyldon_10</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>8</tipid>
            <area>tyldon</area>
            <locastring>tyldon_8</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>11</tipid>
            <area>tyldon</area>
            <locastring>tyldon_11</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>9</tipid>
            <area>tyldon</area>
            <locastring>tyldon_9</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="rybon">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>rybon</area>
            <locastring>rybon_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>rybon</area>
            <locastring>rybon_6</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="phexcaer">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>35</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_35</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>39</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_39</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>38</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_38</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>41</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_41</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>34</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_34</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>37</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_37</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>40</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_40</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>31</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_31</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>32</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_32</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>26</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_26</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>29</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_29</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>30</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_30</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>27</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_27</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>28</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_28</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>33</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_33</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>36</tipid>
            <area>phexcaer</area>
            <locastring>phexcaer_36</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
    <item key="groenvel">
      <QBTipArea>
        <tiplist>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>7</tipid>
            <area>groenvel</area>
            <locastring>groenvel_7</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>5</tipid>
            <area>groenvel</area>
            <locastring>groenvel_5</locastring>
          </QBTipEntry>
          <QBTipEntry>
            <received>
              <timestamp>0</timestamp>
            </received>
            <tipid>6</tipid>
            <area>groenvel</area>
            <locastring>groenvel_6</locastring>
          </QBTipEntry>
        </tiplist>
      </QBTipArea>
    </item>
  </tips>
  <genstate>
    <item key="godstate_Travia">
      <GeneralState>
        <val>128</val>
        <fval>0</fval>
        <sval>25</sval>
      </GeneralState>
    </item>
    <item key="firstlevelupdone">
      <GeneralState>
        <val>0</val>
        <fval>0</fval>
      </GeneralState>
    </item>
    <item key="godstate_Efferd">
      <GeneralState>
        <val>132</val>
        <fval>0</fval>
        <sval>24</sval>
      </GeneralState>
    </item>
    <item key="godstate_Peraine">
      <GeneralState>
        <val>114</val>
        <fval>0</fval>
        <sval>31</sval>
      </GeneralState>
    </item>
    <item key="godstate_Tsa">
      <GeneralState>
        <val>151</val>
        <fval>0</fval>
        <sval>29</sval>
      </GeneralState>
    </item>
    <item key="godstate_Phex">
      <GeneralState>
        <val>116</val>
        <fval>0</fval>
        <sval>30</sval>
      </GeneralState>
    </item>
    <item key="godstate_Praios">
      <GeneralState>
        <val>110</val>
        <fval>0</fval>
        <sval>22</sval>
      </GeneralState>
    </item>
    <item key="godstate_Rondra">
      <GeneralState>
        <val>113</val>
        <fval>0</fval>
        <sval>23</sval>
      </GeneralState>
    </item>
    <item key="godstate_Boron">
      <GeneralState>
        <val>220</val>
        <fval>0</fval>
        <sval>26</sval>
      </GeneralState>
    </item>
    <item key="godstate_Hesinde">
      <GeneralState>
        <val>241</val>
        <fval>0</fval>
        <sval>27</sval>
      </GeneralState>
    </item>
    <item key="godstate_Firun">
      <GeneralState>
        <val>118</val>
        <fval>0</fval>
        <sval>28</sval>
      </GeneralState>
    </item>
    <item key="godstate_Ingerimm">
      <GeneralState>
        <val>113</val>
        <fval>0</fval>
        <sval>32</sval>
      </GeneralState>
    </item>
    <item key="godstate_Rahja">
      <GeneralState>
        <val>111</val>
        <fval>0</fval>
        <sval>33</sval>
      </GeneralState>
    </item>
  </genstate>
  <compstate>
    <item key="ardora">
      <CompanionState>
        <nextEvent>
          <timestamp>1047.67834</timestamp>
        </nextEvent>
        <active>true</active>
        <name>ardora</name>
      </CompanionState>
    </item>
    <item key="erwo">
      <CompanionState>
        <nextEvent>
          <timestamp>213.592117</timestamp>
        </nextEvent>
        <active>true</active>
        <name>erwo</name>
      </CompanionState>
    </item>
    <item key="curian">
      <CompanionState>
        <nextEvent>
          <timestamp>533.68866</timestamp>
        </nextEvent>
        <active>true</active>
        <name>curian</name>
      </CompanionState>
    </item>
    <item key="garsvik">
      <CompanionState>
        <nextEvent>
          <timestamp>760.7576</timestamp>
        </nextEvent>
        <active>true</active>
        <pc>
          <attribs>
            <item key="Level">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="44" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="-2" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="8" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="11" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="8" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="11" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="9" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="1050" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="9" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="182" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="3280" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.9843261" />
            </item>
            <item key="thirst">
              <Attribute val="2" fraction="0.6788333" />
            </item>
            <item key="AG">
              <Attribute val="6" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="7" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="6" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="39" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="39" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="0" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="8" atbonus="4" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="7" atbonus="4" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="0" atbonus="0" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="4" atbonus="2" />
            </item>
            <item key="aexte">
              <WeaponSkill name="aexte" value="8" atbonus="4" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="2" atbonus="1" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="2" atbonus="1" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="-3" atbonus="-2" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="5" atbonus="0" />
            </item>
          </weaponskills>
          <skills>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="-1" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="8" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="7" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="-1" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="-1" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="10" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="9" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="0" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="-2" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="10" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="0" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="-2" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="-2" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="0" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="1" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="-5" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="3" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="8" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="-4" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="-2" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="-2" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="-4" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="-1" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="2" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="1" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="2" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="0" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="2" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="-3" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="1" />
            </item>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="-4" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="-2" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="0" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="-1" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="2" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="3" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="1" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="0" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="-2" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="-3" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="5" />
            </item>
          </skills>
          <magicskills>
            <item key="beherrschung">
              <MagicSkill value="-19" name="beherrschung" />
            </item>
            <item key="gardianum">
              <MagicSkill value="-19" name="gardianum" />
            </item>
            <item key="illusionen">
              <MagicSkill value="-19" name="illusionen" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="-19" name="geisterbannen" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="-19" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="-19" name="bannbaladin" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="-19" name="horriphobus" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="respondami">
              <MagicSkill value="-19" name="respondami" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="-19" name="sanftmut" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="-19" name="skelettarius" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="-19" name="somnigravis" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="-19" name="aeolitus" />
            </item>
            <item key="flimflam">
              <MagicSkill value="-19" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="-19" name="foramen" />
            </item>
            <item key="motoricus">
              <MagicSkill value="-19" name="motoricus" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="silentium">
              <MagicSkill value="-19" name="silentium" />
            </item>
            <item key="solidirid">
              <MagicSkill value="-19" name="solidirid" />
            </item>
            <item key="balsam">
              <MagicSkill value="-19" name="balsam" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="-19" name="klarumpurum" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="-19" name="ruhekoerper" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="adleraug">
              <MagicSkill value="-19" name="adleraug" />
            </item>
            <item key="analues">
              <MagicSkill value="-19" name="analues" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="-19" name="eigenschaften" />
            </item>
            <item key="exposami">
              <MagicSkill value="-19" name="exposami" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="-19" name="odemarcanum" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="-19" name="penetrizzel" />
            </item>
            <item key="sensibar">
              <MagicSkill value="-19" name="sensibar" />
            </item>
            <item key="blitz">
              <MagicSkill value="-19" name="blitz" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="-19" name="eisenrost" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="-19" name="fulminictus" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="-19" name="ignifaxius" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="-19" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="-19" name="saftkraft" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="-19" name="scharfesauge" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="-19" name="adlerwolf" />
            </item>
            <item key="arcano">
              <MagicSkill value="-19" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="-19" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="-19" name="axxeleratus" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="-19" name="chsteigern" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="paralue">
              <MagicSkill value="-19" name="paralue" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="-19" name="seeundfluss" />
            </item>
            <item key="visibili">
              <MagicSkill value="-19" name="visibili" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>144</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>10</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>72</itemid>
                <BF>-1</BF>
                <itemrep>957</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>92</itemid>
                <BF>-1</BF>
                <itemrep>148</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>112</itemid>
                <BF>2</BF>
                <itemrep>221</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory06">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>38</itemid>
                <BF>-1</BF>
                <itemrep>546</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>2</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory07">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>3</itemid>
                <BF>2</BF>
                <itemrep>897</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory08">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory09">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory10">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory11">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory12">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory13">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory14">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory15">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory16">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory17">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory18">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item xsi:nil="true" />
            </item>
            <item key="chest">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>81</itemid>
                <BF>-1</BF>
                <itemrep>561</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item xsi:nil="true" />
            </item>
            <item key="head">
              <Item xsi:nil="true" />
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item xsi:nil="true" />
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>197</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item xsi:nil="true" />
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item xsi:nil="true" />
            </item>
            <item key="shield">
              <Item xsi:nil="true" />
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>50</itemid>
                <BF>-1</BF>
                <itemrep>565</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item xsi:nil="true" />
            </item>
            <item key="weapon">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>136</itemid>
                <BF>2</BF>
                <itemrep>406</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog />
          <receivedwonders />
          <charsetup>
            <maintexid>1</maintexid>
            <weaptexid>-1</weaptexid>
            <id />
            <acc>
              <string>barbarian_fat</string>
              <string>dwarf_head_beard_01</string>
              <string>barbarian_helmet_04</string>
              <string>barbarian_cloth_02</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>m</geschlecht>
          <klasse>
            <cclass>viking</cclass>
            <school>0</school>
          </klasse>
          <isCompanion>true</isCompanion>
          <magicUses>0</magicUses>
          <birthday>15</birthday>
          <longname>Garsvik Thorfinsson</longname>
          <shortname>Garsvik</shortname>
          <charpic>thorwaler_01.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>06e4f0db-0c00-4c70-afa0-2ecf61b99ed3</uniqueid>
          <id>-1</id>
        </pc>
        <name>garsvik</name>
      </CompanionState>
    </item>
    <item key="nariell">
      <CompanionState>
        <nextEvent>
          <timestamp>874.647034</timestamp>
        </nextEvent>
        <active>true</active>
        <name>nariell</name>
      </CompanionState>
    </item>
    <item key="harika">
      <CompanionState>
        <nextEvent>
          <timestamp>945.966736</timestamp>
        </nextEvent>
        <active>true</active>
        <name>harika</name>
      </CompanionState>
    </item>
    <item key="wanadis">
      <CompanionState>
        <nextEvent>
          <timestamp>903.504333</timestamp>
        </nextEvent>
        <active>true</active>
        <pc>
          <attribs>
            <item key="Level">
              <Attribute val="8" fraction="0" />
            </item>
            <item key="LE">
              <Attribute val="51" fraction="0" />
            </item>
            <item key="cLE">
              <Attribute val="51" fraction="0" />
            </item>
            <item key="AE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="cAE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="MR">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="RS">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="BP">
              <Attribute val="8" fraction="0" />
            </item>
            <item key="BE">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="AT">
              <Attribute val="11" fraction="0" />
            </item>
            <item key="PA">
              <Attribute val="10" fraction="0" />
            </item>
            <item key="MU">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="KL">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="CH">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="FF">
              <Attribute val="12" fraction="0" />
            </item>
            <item key="GE">
              <Attribute val="14" fraction="0" />
            </item>
            <item key="IN">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="KK">
              <Attribute val="13" fraction="0" />
            </item>
            <item key="XP">
              <Attribute val="3448" fraction="0" />
            </item>
            <item key="Geld">
              <Attribute val="714" fraction="0" />
            </item>
            <item key="Gottheit">
              <Attribute val="11" fraction="0" />
            </item>
            <item key="size">
              <Attribute val="176" fraction="0" />
            </item>
            <item key="weight">
              <Attribute val="2920" fraction="0" />
            </item>
            <item key="hunger">
              <Attribute val="1" fraction="0.0394276" />
            </item>
            <item key="thirst">
              <Attribute val="3" fraction="0.118286908" />
            </item>
            <item key="AG">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="HA">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="RA">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="GG">
              <Attribute val="3" fraction="0" />
            </item>
            <item key="TA">
              <Attribute val="4" fraction="0" />
            </item>
            <item key="NG">
              <Attribute val="2" fraction="0" />
            </item>
            <item key="JZ">
              <Attribute val="5" fraction="0" />
            </item>
            <item key="AU">
              <Attribute val="41" fraction="0" />
            </item>
            <item key="cAU">
              <Attribute val="41" fraction="0" />
            </item>
            <item key="ini">
              <Attribute val="0" fraction="0" />
            </item>
            <item key="KO">
              <Attribute val="15" fraction="0" />
            </item>
            <item key="FK">
              <Attribute val="0" fraction="0" />
            </item>
          </attribs>
          <durableEffect />
          <battleStance>2</battleStance>
          <weaponskills>
            <item key="aexte">
              <WeaponSkill name="aexte" value="2" atbonus="2" />
            </item>
            <item key="hiebwaffen">
              <WeaponSkill name="hiebwaffen" value="3" atbonus="2" />
            </item>
            <item key="schusswaffen">
              <WeaponSkill name="schusswaffen" value="6" atbonus="6" />
            </item>
            <item key="schwerter">
              <WeaponSkill name="schwerter" value="0" atbonus="0" />
            </item>
            <item key="speere">
              <WeaponSkill name="speere" value="-2" atbonus="-1" />
            </item>
            <item key="stichwaffen">
              <WeaponSkill name="stichwaffen" value="5" atbonus="3" />
            </item>
            <item key="waffenlos">
              <WeaponSkill name="waffenlos" value="5" atbonus="4" />
            </item>
            <item key="wurfwaffen">
              <WeaponSkill name="wurfwaffen" value="0" atbonus="0" />
            </item>
            <item key="zweihaender">
              <WeaponSkill name="zweihaender" value="-3" atbonus="-2" />
            </item>
          </weaponskills>
          <skills>
            <item key="abrichten">
              <StandardSkill name="abrichten" value="1" />
            </item>
            <item key="akrobatik">
              <StandardSkill name="akrobatik" value="6" />
            </item>
            <item key="alchimie">
              <StandardSkill name="alchimie" value="-5" />
            </item>
            <item key="altespr">
              <StandardSkill name="altespr" value="2" />
            </item>
            <item key="betoeren">
              <StandardSkill name="betoeren" value="7" />
            </item>
            <item key="faehrtens">
              <StandardSkill name="faehrtens" value="10" />
            </item>
            <item key="fahrzeuge">
              <StandardSkill name="fahrzeuge" value="2" />
            </item>
            <item key="falschspiel">
              <StandardSkill name="falschspiel" value="0" />
            </item>
            <item key="fesseln">
              <StandardSkill name="fesseln" value="2" />
            </item>
            <item key="gassenwissen">
              <StandardSkill name="gassenwissen" value="9" />
            </item>
            <item key="gefahrensinn">
              <StandardSkill name="gefahrensinn" value="8" />
            </item>
            <item key="geographie">
              <StandardSkill name="geographie" value="11" />
            </item>
            <item key="geschichte">
              <StandardSkill name="geschichte" value="5" />
            </item>
            <item key="goetterkulte">
              <StandardSkill name="goetterkulte" value="6" />
            </item>
            <item key="heilengift">
              <StandardSkill name="heilengift" value="-1" />
            </item>
            <item key="heilenkrankh">
              <StandardSkill name="heilenkrankh" value="2" />
            </item>
            <item key="heilenwunde">
              <StandardSkill name="heilenwunde" value="3" />
            </item>
            <item key="klettern">
              <StandardSkill name="klettern" value="5" />
            </item>
            <item key="koerperb">
              <StandardSkill name="koerperb" value="12" />
            </item>
            <item key="kriegskunst">
              <StandardSkill name="kriegskunst" value="2" />
            </item>
            <item key="lesen">
              <StandardSkill name="lesen" value="13" />
            </item>
            <item key="magiek">
              <StandardSkill name="magiek" value="-2" />
            </item>
            <item key="menschenk">
              <StandardSkill name="menschenk" value="10" />
            </item>
            <item key="musizieren">
              <StandardSkill name="musizieren" value="0" />
            </item>
            <item key="orientierung">
              <StandardSkill name="orientierung" value="13" />
            </item>
            <item key="pflanzenk">
              <StandardSkill name="pflanzenk" value="6" />
            </item>
            <item key="reiten">
              <StandardSkill name="reiten" value="18" />
            </item>
            <item key="schaetzen">
              <StandardSkill name="schaetzen" value="4" />
            </item>
            <item key="schleichen">
              <StandardSkill name="schleichen" value="5" />
            </item>
            <item key="schloesser">
              <StandardSkill name="schloesser" value="0" />
            </item>
            <item key="schwimmen">
              <StandardSkill name="schwimmen" value="10" />
            </item>
            <item key="selbstbeh">
              <StandardSkill name="selbstbeh" value="12" />
            </item>
            <item key="sinnensch">
              <StandardSkill name="sinnensch" value="10" />
            </item>
            <item key="sprachen">
              <StandardSkill name="sprachen" value="5" />
            </item>
            <item key="tanzen">
              <StandardSkill name="tanzen" value="6" />
            </item>
            <item key="taschendieb">
              <StandardSkill name="taschendieb" value="-1" />
            </item>
            <item key="tierkunde">
              <StandardSkill name="tierkunde" value="5" />
            </item>
            <item key="ueberreden">
              <StandardSkill name="ueberreden" value="8" />
            </item>
            <item key="verstecken">
              <StandardSkill name="verstecken" value="8" />
            </item>
            <item key="wildnisleben">
              <StandardSkill name="wildnisleben" value="11" />
            </item>
            <item key="zechen">
              <StandardSkill name="zechen" value="5" />
            </item>
          </skills>
          <magicskills>
            <item key="adleraug">
              <MagicSkill value="-19" name="adleraug" />
            </item>
            <item key="adlerwolf">
              <MagicSkill value="-19" name="adlerwolf" />
            </item>
            <item key="aeolitus">
              <MagicSkill value="-19" name="aeolitus" />
            </item>
            <item key="analues">
              <MagicSkill value="-19" name="analues" />
            </item>
            <item key="arcano">
              <MagicSkill value="-19" name="arcano" />
            </item>
            <item key="armatrutz">
              <MagicSkill value="-19" name="armatrutz" />
            </item>
            <item key="axxeleratus">
              <MagicSkill value="-19" name="axxeleratus" />
            </item>
            <item key="balsam">
              <MagicSkill value="-19" name="balsam" />
            </item>
            <item key="bandundfessel">
              <MagicSkill value="-19" name="bandundfessel" />
            </item>
            <item key="bannbaladin">
              <MagicSkill value="-19" name="bannbaladin" />
            </item>
            <item key="beherrschung">
              <MagicSkill value="-19" name="beherrschung" />
            </item>
            <item key="blitz">
              <MagicSkill value="-19" name="blitz" />
            </item>
            <item key="boeserblick">
              <MagicSkill value="-19" name="boeserblick" />
            </item>
            <item key="chsteigern">
              <MagicSkill value="-19" name="chsteigern" />
            </item>
            <item key="eigenschaften">
              <MagicSkill value="-19" name="eigenschaften" />
            </item>
            <item key="eisenrost">
              <MagicSkill value="-19" name="eisenrost" />
            </item>
            <item key="exposami">
              <MagicSkill value="-19" name="exposami" />
            </item>
            <item key="feuerbann">
              <MagicSkill value="-19" name="feuerbann" />
            </item>
            <item key="flimflam">
              <MagicSkill value="-19" name="flimflam" />
            </item>
            <item key="foramen">
              <MagicSkill value="-19" name="foramen" />
            </item>
            <item key="fulminictus">
              <MagicSkill value="-19" name="fulminictus" />
            </item>
            <item key="gardianum">
              <MagicSkill value="-19" name="gardianum" />
            </item>
            <item key="geisterbannen">
              <MagicSkill value="-19" name="geisterbannen" />
            </item>
            <item key="geisterrufen">
              <MagicSkill value="-19" name="geisterrufen" />
            </item>
            <item key="grverwirrung">
              <MagicSkill value="-19" name="grverwirrung" />
            </item>
            <item key="harmlos">
              <MagicSkill value="-19" name="harmlos" />
            </item>
            <item key="herrdertiere">
              <MagicSkill value="-19" name="herrdertiere" />
            </item>
            <item key="hexenblick">
              <MagicSkill value="-19" name="hexenblick" />
            </item>
            <item key="hexenknoten">
              <MagicSkill value="-19" name="hexenknoten" />
            </item>
            <item key="hexenspeichel">
              <MagicSkill value="-19" name="hexenspeichel" />
            </item>
            <item key="horriphobus">
              <MagicSkill value="-19" name="horriphobus" />
            </item>
            <item key="ignifaxius">
              <MagicSkill value="-19" name="ignifaxius" />
            </item>
            <item key="illusionen">
              <MagicSkill value="-19" name="illusionen" />
            </item>
            <item key="klarumpurum">
              <MagicSkill value="-19" name="klarumpurum" />
            </item>
            <item key="kraehenruf">
              <MagicSkill value="-19" name="kraehenruf" />
            </item>
            <item key="magischerraub">
              <MagicSkill value="-19" name="magischerraub" />
            </item>
            <item key="motoricus">
              <MagicSkill value="-19" name="motoricus" />
            </item>
            <item key="nihilatio">
              <MagicSkill value="-19" name="nihilatio" />
            </item>
            <item key="odemarcanum">
              <MagicSkill value="-19" name="odemarcanum" />
            </item>
            <item key="paralue">
              <MagicSkill value="-19" name="paralue" />
            </item>
            <item key="penetrizzel">
              <MagicSkill value="-19" name="penetrizzel" />
            </item>
            <item key="plumbumbarum">
              <MagicSkill value="-19" name="plumbumbarum" />
            </item>
            <item key="radau">
              <MagicSkill value="-19" name="radau" />
            </item>
            <item key="respondami">
              <MagicSkill value="-19" name="respondami" />
            </item>
            <item key="ruhekoerper">
              <MagicSkill value="-19" name="ruhekoerper" />
            </item>
            <item key="saftkraft">
              <MagicSkill value="-19" name="saftkraft" />
            </item>
            <item key="sanftmut">
              <MagicSkill value="-19" name="sanftmut" />
            </item>
            <item key="scharfesauge">
              <MagicSkill value="-19" name="scharfesauge" />
            </item>
            <item key="seeundfluss">
              <MagicSkill value="-19" name="seeundfluss" />
            </item>
            <item key="sensibar">
              <MagicSkill value="-19" name="sensibar" />
            </item>
            <item key="silentium">
              <MagicSkill value="-19" name="silentium" />
            </item>
            <item key="skelettarius">
              <MagicSkill value="-19" name="skelettarius" />
            </item>
            <item key="solidirid">
              <MagicSkill value="-19" name="solidirid" />
            </item>
            <item key="somnigravis">
              <MagicSkill value="-19" name="somnigravis" />
            </item>
            <item key="tiereheilen">
              <MagicSkill value="-19" name="tiereheilen" />
            </item>
            <item key="transversalis">
              <MagicSkill value="-19" name="transversalis" />
            </item>
            <item key="verwandlung">
              <MagicSkill value="-19" name="verwandlung" />
            </item>
            <item key="visibili">
              <MagicSkill value="-19" name="visibili" />
            </item>
            <item key="zwingtanz">
              <MagicSkill value="-19" name="zwingtanz" />
            </item>
          </magicskills>
          <inventory>
            <item key="inventory01">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>45</itemid>
                <BF>-1</BF>
                <itemrep>866</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>2</count>
              </Item>
            </item>
            <item key="inventory02">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>30</itemid>
                <BF>-1</BF>
                <itemrep>112</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>3</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory03">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>72</itemid>
                <BF>-1</BF>
                <itemrep>232</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory04">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>67</itemid>
                <BF>3</BF>
                <itemrep>973</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="inventory05">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory06">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory07">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory08">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory09">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory10">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory11">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory12">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory13">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory14">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory15">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory16">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory17">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory18">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory19">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory20">
              <Item xsi:nil="true" />
            </item>
            <item key="inventory21">
              <Item xsi:nil="true" />
            </item>
            <item key="belly">
              <Item xsi:nil="true" />
            </item>
            <item key="chest">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>48</itemid>
                <BF>-1</BF>
                <itemrep>266</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="coat">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>96</itemid>
                <BF>-1</BF>
                <itemrep>616</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="head">
              <Item xsi:nil="true" />
            </item>
            <item key="leftarm">
              <Item xsi:nil="true" />
            </item>
            <item key="leftring">
              <Item xsi:nil="true" />
            </item>
            <item key="leg">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>49</itemid>
                <BF>-1</BF>
                <itemrep>104</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="neck">
              <Item xsi:nil="true" />
            </item>
            <item key="rightarm">
              <Item xsi:nil="true" />
            </item>
            <item key="rightring">
              <Item xsi:nil="true" />
            </item>
            <item key="shield">
              <Item xsi:nil="true" />
            </item>
            <item key="shoe">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>51</itemid>
                <BF>-1</BF>
                <itemrep>248</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
            <item key="underleg">
              <Item xsi:nil="true" />
            </item>
            <item key="upperarm">
              <Item xsi:nil="true" />
            </item>
            <item key="weapon">
              <Item>
                <recognized>false</recognized>
                <level>0</level>
                <varusestype />
                <itemid>67</itemid>
                <BF>3</BF>
                <itemrep>984</itemrep>
                <isMagical>false</isMagical>
                <isBroken>false</isBroken>
                <uses>0</uses>
                <count>1</count>
              </Item>
            </item>
          </inventory>
          <xplog>
            <string>Battle Beilunk_Kampf1 won: 6</string>
            <string>Battle camp_road_1 won: 0</string>
            <string>Battle camp_road_3 won: 0</string>
            <string>Battle Seereise_Piratenangriff3 won: 0</string>
          </xplog>
          <receivedwonders />
          <charsetup>
            <maintexid>1</maintexid>
            <weaptexid>-1</weaptexid>
            <id />
            <acc>
              <string>elf_female_02</string>
              <string>elf_hair_01</string>
              <string>elf_arm_fur</string>
            </acc>
          </charsetup>
          <escaped>false</escaped>
          <geschlecht>w</geschlecht>
          <klasse>
            <cclass>breiter</cclass>
            <school>0</school>
          </klasse>
          <isCompanion>true</isCompanion>
          <campDuty />
          <magicUses>0</magicUses>
          <birthday>5</birthday>
          <longname>Wanadis Foradsdottir</longname>
          <shortname>Wanadis</shortname>
          <charpic>streunerin_05.jpg</charpic>
          <charpicid>0</charpicid>
          <uniqueid>834b94ec-86f1-4caf-abde-b7236d534f5f</uniqueid>
          <id>7</id>
        </pc>
        <name>wanadis</name>
      </CompanionState>
    </item>
  </compstate>
  <knownPlaces>
    <int>21</int>
    <int>55</int>
    <int>20</int>
    <int>18</int>
    <int>27</int>
    <int>26</int>
    <int>19</int>
    <int>58</int>
    <int>40</int>
    <int>39</int>
    <int>38</int>
    <int>16</int>
    <int>9</int>
    <int>10</int>
    <int>7</int>
    <int>11</int>
    <int>12</int>
    <int>5</int>
    <int>1</int>
    <int>3</int>
    <int>4</int>
    <int>59</int>
    <int>17</int>
    <int>33</int>
    <int>36</int>
    <int>35</int>
    <int>37</int>
    <int>46</int>
    <int>47</int>
    <int>49</int>
    <int>50</int>
    <int>52</int>
    <int>51</int>
    <int>43</int>
    <int>44</int>
    <int>15</int>
    <int>14</int>
    <int>28</int>
    <int>29</int>
    <int>31</int>
    <int>30</int>
    <int>60</int>
    <int>25</int>
    <int>24</int>
    <int>23</int>
    <int>22</int>
    <int>34</int>
  </knownPlaces>
  <knownEvents>
    <string>ALLrandomStreetstrasse_Haendler2</string>
    <string>ALLrandomStreetstrasse_Haendler1</string>
    <string>thorwalrandomStreetstrasse_hetmannauftrag</string>
    <string>ALLrandomStreetstreet_topf</string>
    <string>ALLrandomStreetstreet_novadis</string>
    <string>ALLrandomStreetstrasse_Kind1</string>
    <string>ALLrandomStreet</string>
    <string>ALLrandomStreetstrasse_Haendler3</string>
    <string>ALLrandomStreetaxegroin</string>
    <string>thorwal33-62</string>
    <string>thorwalrandomStreetstartdlg("strasse_HansQuest2");</string>
    <string>ALLrandomStreetstrasse_stinkt2</string>
    <string>ALLrandomStreetstrasse_Haendler4</string>
    <string>felsteyn64-95</string>
    <string>brendhilrandomStreetstartdlg("strasse_HansQuest2");</string>
    <string>rukianenterTown</string>
    <string>groenvelgroup1</string>
    <string>groenvelgroup2</string>
    <string>groenvelgroup3</string>
    <string>groenvelgroup4</string>
  </knownEvents>
  <knownRecipes>
    <string>hylailerfeuer</string>
    <string>heiltrank</string>
    <string>wunderkur</string>
    <string>mu_elixier</string>
    <string>expurgicum</string>
    <string>vomicum</string>
    <string>kk_elixier</string>
    <string>zaubertrank_big</string>
    <string>heiltrank_big</string>
  </knownRecipes>
  <mappieces>
    <boolean>false</boolean>
    <boolean>false</boolean>
    <boolean>false</boolean>
    <boolean>false</boolean>
    <boolean>false</boolean>
    <boolean>false</boolean>
    <boolean>false</boolean>
    <boolean>false</boolean>
    <boolean>false</boolean>
  </mappieces>
  <guardlist>
    <int>1</int>
    <int>5</int>
    <int>6</int>
  </guardlist>
  <currentTime>1061.40381</currentTime>
  <savedJourney>
    <percOnRoute>-8.71894663E-05</percOnRoute>
    <lastUpdate>365.560547</lastUpdate>
    <travelDir>-1</travelDir>
    <lastBreak>363.22934</lastBreak>
    <lastCheck>363.396</lastCheck>
    <forcedmarch>false</forcedmarch>
    <startloc>runinsha</startloc>
    <shipPassageSpeed>1.72637045</shipPassageSpeed>
    <nextAUupdate>363.271</nextAUupdate>
    <nextRandomCheck>366</nextRandomCheck>
    <nextRandomTime>367</nextRandomTime>
    <moving>false</moving>
    <routeName>prem-runinsha</routeName>
    <breakReason>arrival</breakReason>
  </savedJourney>
  <weather>
    <tempNight>-1</tempNight>
    <tempDay>19</tempDay>
    <wind>light</wind>
    <cloud>some</cloud>
    <rain>none</rain>
  </weather>
  <diff>
    <CommonSickness>true</CommonSickness>
    <UncommonSickness>true</UncommonSickness>
    <Fumble>true</Fumble>
    <WeaponDestruction>true</WeaponDestruction>
    <RestBattle>true</RestBattle>
    <NecroChecks>true</NecroChecks>
    <Hunger>true</Hunger>
    <Thirst>true</Thirst>
  </diff>
  <dungeonhint>true</dungeonhint>
  <ignoreTimeout>true</ignoreTimeout>
  <cCompanion />
  <schickmap>
    <hasMappart>
      <boolean>true</boolean>
      <boolean>true</boolean>
      <boolean>true</boolean>
      <boolean>true</boolean>
      <boolean>true</boolean>
      <boolean>true</boolean>
      <boolean>true</boolean>
      <boolean>true</boolean>
      <boolean>true</boolean>
    </hasMappart>
    <hasFalsePiece>false</hasFalsePiece>
  </schickmap>
  <ISactive />
  <ISid />
  <savedVersion>131</savedVersion>
</Party>